ID: 962769689

View in Genome Browser
Species Human (GRCh38)
Location 3:138600901-138600923
Sequence AAGAAGGAGGAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962769682_962769689 14 Left 962769682 3:138600864-138600886 CCTGTGAAGAAGAGGAAGAAAAG No data
Right 962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG No data
962769680_962769689 28 Left 962769680 3:138600850-138600872 CCTGAGCAATATAGCCTGTGAAG No data
Right 962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962769689 Original CRISPR AAGAAGGAGGAGAAGGAGGG AGG Intergenic
No off target data available for this crispr