ID: 962775245

View in Genome Browser
Species Human (GRCh38)
Location 3:138652933-138652955
Sequence GATGCTGATGCTCCTCATCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962775243_962775245 -8 Left 962775243 3:138652918-138652940 CCAGTTCTCTCTGGTGATGCTGA 0: 1
1: 0
2: 1
3: 23
4: 201
Right 962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG 0: 1
1: 0
2: 6
3: 64
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962775245 Original CRISPR GATGCTGATGCTCCTCATCA GGG Exonic
901218495 1:7568315-7568337 GATGCTGGTGATCCTGATGAGGG - Intronic
902212559 1:14914207-14914229 GATGCTGCTGCAGCTGATCAGGG + Intronic
902271890 1:15310582-15310604 GATGCTGATGCTGCTGGTCCAGG - Intronic
902951519 1:19886841-19886863 GATGCTGATGCTCCTAGTCCGGG + Intronic
903942251 1:26939825-26939847 GATGCTGATGCTGCAGGTCAGGG + Intronic
904539182 1:31221328-31221350 GATGCTGATGCTGCTAGTCCAGG - Intronic
904974069 1:34442579-34442601 GATGCTGATGCTGCTGGTCTGGG + Intergenic
904975230 1:34451093-34451115 GATGCTGATGCTGCTGGTCCAGG - Intergenic
905214376 1:36396600-36396622 GATGCTGATGCTGCTGGTCAGGG + Intronic
905588479 1:39141377-39141399 GATGCTGATGCTGCTGGTCTGGG + Intronic
905637940 1:39567924-39567946 GATGCTGGTGCTCCTGGTCTGGG - Intronic
906292518 1:44628574-44628596 AAAGCTGAAGCTCCTTATCATGG + Intronic
907002854 1:50879693-50879715 GATGCTGATGCTGCTGGTCTAGG - Intronic
907788047 1:57633396-57633418 GATGCTGATGCTGCTGAACCTGG + Intronic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
909169880 1:72282205-72282227 AATGCTGGTGGTGCTCATCATGG - Intronic
909192347 1:72570078-72570100 AATGCTGATGCTACTCTTCTGGG - Intergenic
909342762 1:74550163-74550185 GATGCTGATGCTGCTTGTCCTGG + Intergenic
909344373 1:74568966-74568988 TGTGCTGATGCTTCTGATCAAGG + Exonic
909488062 1:76196342-76196364 GATACTGATGCTGCTCCTCTGGG + Intronic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
912919720 1:113854268-113854290 GATGCTGATGCTTCTTGTCTGGG + Intronic
912992918 1:114507321-114507343 GATGCTGATGCTGTTGATCCAGG + Intronic
913312283 1:117512473-117512495 GATGCTGATGCTGCTGGTCTGGG + Intronic
914787151 1:150844524-150844546 GTTGCTGATGCTCCTGGTCTCGG - Intronic
916250758 1:162735524-162735546 GATGCTGATGCTGCTGGTCCTGG + Intronic
916381518 1:164217008-164217030 GATGTTGATGTACATCATCATGG - Intergenic
917767716 1:178241597-178241619 AATCCTGATGCTCATGATCAAGG - Intronic
917924801 1:179780541-179780563 GATGCTGATGTTGCTCATCTGGG - Intronic
917966985 1:180185140-180185162 GCTGCCTATGCTCCTCCTCAGGG - Intronic
918334058 1:183489925-183489947 GATGCTGATGATGCTCATCTGGG - Intronic
918594668 1:186279186-186279208 GATGCTGATGCTGCTGGTCCAGG - Intergenic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
919943655 1:202305061-202305083 GAATCTGAGGCTCCTCATCAGGG + Intronic
921132690 1:212233178-212233200 GATGCTGCTGCTGCTGATCTGGG + Intergenic
922033090 1:221823361-221823383 GATGCTGATGCTGCTGGTCCAGG + Intergenic
922180230 1:223227637-223227659 GGTGCTGCTGCTCGTCATCCTGG - Exonic
922491702 1:226022411-226022433 GATGCTGATGCTCCAGTCCAGGG - Intergenic
922565652 1:226600025-226600047 GATGCTGATGTGCCCCATCCTGG - Intronic
923044450 1:230345303-230345325 GACGCTGAGGCTGCTCATCCTGG - Intronic
923638770 1:235729004-235729026 GATGCTGATGCTACTAATTCAGG + Intronic
923741574 1:236659505-236659527 GTTGCTGATGGTCCTCTCCAGGG - Intergenic
924154904 1:241165894-241165916 GATGCAGATGCTTCTGATCTGGG - Intronic
924568239 1:245215454-245215476 GAAGCAGATGCTGCTCCTCAGGG + Intronic
1062927786 10:1329845-1329867 TTTGCTGATGCTCCTCATGAAGG + Intronic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1064906278 10:20349222-20349244 GATCCTGATGCCACTAATCAAGG + Intergenic
1065476571 10:26144770-26144792 GATGCTGATGTTCCTGGGCAGGG - Intronic
1065770380 10:29072620-29072642 GATGCTGATGCTACTGCTCTGGG - Intergenic
1067791644 10:49292886-49292908 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1068012776 10:51475283-51475305 GATGCTGATGCTGCTGTTCCAGG - Intronic
1068222326 10:54059684-54059706 GATGCTGATGCTGCTTTTCCAGG + Intronic
1069191651 10:65498555-65498577 GATGCTGATGCTGCTAATCTAGG + Intergenic
1069287887 10:66739347-66739369 GATGCTGATGCTGCTGCTCTGGG + Intronic
1069443423 10:68450394-68450416 GATGCTGATGCTACTGGTCCAGG - Intronic
1069879678 10:71583954-71583976 GATGCTGATGCTGCTGCTCTGGG - Intronic
1070512137 10:77171125-77171147 GATGCTGCTGCTGCTGATCTGGG - Intronic
1070742676 10:78913115-78913137 GATGCTGATGCTGCTGGTCCTGG + Intergenic
1070938729 10:80323540-80323562 GATGCTGAGGCTGCTAGTCAAGG - Intergenic
1071402019 10:85282590-85282612 GATGCTGATGCTGCTGCTCCAGG - Intergenic
1071831765 10:89379240-89379262 GATGCTGATGTTGCTAGTCAGGG - Intronic
1072436696 10:95420740-95420762 GATGCTTATCCTCCTCAGCGTGG - Intronic
1072576377 10:96704383-96704405 GATGCTGATGCTGCTGGTCCAGG - Intronic
1074143300 10:110695996-110696018 GATGCTGATGCTGCTGGTCCAGG - Intronic
1074430998 10:113394572-113394594 GATGCTGTTGCTGCTAATCAGGG + Intergenic
1075226788 10:120636806-120636828 GATGCTGATGCTGCTGATCTAGG + Intergenic
1075329256 10:121560932-121560954 GATGCTGATGCTGCTGGTCCAGG + Intronic
1075930703 10:126293012-126293034 GATGCTGATGCTGCTGGTCTGGG + Intronic
1075950543 10:126473896-126473918 GATGCTGATGCTACTGCTCCAGG + Intronic
1076079949 10:127570313-127570335 GAGGCTGATCCTCCACATCATGG - Intergenic
1076813030 10:132898986-132899008 GATGCCGATGAGCCTCTTCAGGG + Exonic
1078592356 11:12654693-12654715 TTTGCAGATGCTCTTCATCAAGG - Intergenic
1078647684 11:13157115-13157137 GATGCTGATGTTACTCATCTAGG - Intergenic
1078850839 11:15161760-15161782 TATGCTGATGCAGCTCAGCATGG + Intronic
1080251627 11:30240156-30240178 GATGCTGCTGCTTCTCACTAGGG - Intergenic
1080887084 11:36377010-36377032 GATGCGGATGCTGGTGATCATGG + Intronic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083381229 11:62270222-62270244 GTTGCTGATGGTCCTCATGCTGG + Exonic
1085259815 11:75198037-75198059 GATGCTGATGCCCAGCATGAGGG - Intronic
1086865134 11:91971368-91971390 GATGCGGATGCTGCTGGTCAAGG - Intergenic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1087866241 11:103229947-103229969 GATGCTGATGCTGCTGGTCTAGG - Intronic
1088887848 11:114021516-114021538 GATGCAGATGCTGCTGCTCAGGG - Intergenic
1089037884 11:115414968-115414990 AATGCTGATCCTCCTTATTAGGG - Intronic
1089476010 11:118762585-118762607 GCTGCTGATGCCCAGCATCATGG + Intronic
1089533291 11:119145670-119145692 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1089626449 11:119754159-119754181 GATGCTGATGCTTCTGGTCTCGG - Intergenic
1089635858 11:119811229-119811251 GATGCTGATGCTGCTTGTCCAGG + Intergenic
1092480965 12:8858635-8858657 GATGCCAATGCTCCTGATCTGGG - Intronic
1093115560 12:15206518-15206540 GATGCTGATGCTGCTAGTCTAGG - Intronic
1095601176 12:44014498-44014520 GATGCTGATGCTCCTAAATCTGG + Intronic
1095792727 12:46185239-46185261 GATGCTGATGCTACTGGTCTAGG + Intronic
1096042003 12:48525760-48525782 GATGCTGCTGCTCATGATCAGGG + Exonic
1097301545 12:58024480-58024502 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1097336726 12:58391958-58391980 GATGCTGATACTTCTCATCCAGG - Intergenic
1098440384 12:70511513-70511535 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1098552871 12:71783554-71783576 GATATTGATGCTGCTGATCAGGG - Intronic
1101706719 12:107227406-107227428 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1101759749 12:107648894-107648916 TAAGCTGCTGCTCCTCATGACGG - Intronic
1101800032 12:108013662-108013684 GATGCTGATGCTACTGATTCAGG + Intergenic
1102202272 12:111065760-111065782 GATGCTGATGCTGCTGGTCCAGG - Intronic
1102361142 12:112288707-112288729 TATGCTGAAGCTCGACATCATGG - Intronic
1102460457 12:113096714-113096736 GGTGCTGCGGCTGCTCATCACGG + Exonic
1102623415 12:114215138-114215160 GATGCGGATGCTGCTCATCTGGG - Intergenic
1103065003 12:117890108-117890130 GATGCTGATGCTGCTGGTCCAGG + Intronic
1106511808 13:30419536-30419558 GATCCTCTTGCTCCTCTTCAGGG + Intergenic
1107095495 13:36530824-36530846 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1108013096 13:46041872-46041894 GATACTCATGATCCTCGTCAAGG + Intronic
1108095111 13:46893403-46893425 GATGCTGATGCTGCTGGTCCAGG + Intronic
1108379665 13:49843963-49843985 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1108382686 13:49869233-49869255 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1108566602 13:51705222-51705244 GAAGCAGATTCTCCCCATCAAGG + Intronic
1110278975 13:73670667-73670689 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1110735625 13:78933016-78933038 GTTGCTGATTCTCCTGATAAAGG + Intergenic
1112366000 13:98756001-98756023 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1112369295 13:98781188-98781210 CATGATGATGATCATCATCAAGG - Intergenic
1112781367 13:102904466-102904488 GATGCTGATGCTCCTGGTCTGGG + Intergenic
1114172488 14:20287295-20287317 GATGCTGATGCTGCTGGTCTGGG + Exonic
1116802016 14:49453346-49453368 GAGCCTGATGCTCCCCACCATGG + Intergenic
1117097746 14:52314917-52314939 GATGCTCATGCTCTTCGCCATGG + Exonic
1117258671 14:54006469-54006491 GATGCTGATGCTACTGGTCCAGG - Intergenic
1118621520 14:67618708-67618730 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1119784583 14:77302878-77302900 CATCCTGATGTTCTTCATCATGG - Exonic
1120011854 14:79424893-79424915 CATGATTATGCTCATCATCAAGG - Intronic
1120726010 14:87942249-87942271 GATGCTGATGCTGCTCGTCCAGG + Intronic
1123905633 15:24917685-24917707 GATGTTGGTGCTGCTCTTCAGGG + Intronic
1124181118 15:27475512-27475534 GATGATGATGGTCATCATGATGG + Intronic
1124369489 15:29095792-29095814 CATGCTCATGCTCCTCTTCCCGG + Intronic
1124817988 15:33015929-33015951 GATGCTGATGCTCCTGGTCCAGG - Intronic
1125289849 15:38133957-38133979 GATGCTGATGCTGCTGATCCAGG + Intergenic
1125487239 15:40120491-40120513 GATGCTGATGCTGCTGAACCAGG - Intergenic
1126141502 15:45443099-45443121 GAAGCTGATGCTCCTGGTCTGGG + Intronic
1126550966 15:49928954-49928976 GATGCTGATGCCACTGGTCAGGG - Intronic
1126924062 15:53562491-53562513 GATGCTGATGCTGCTGGTCCAGG + Intronic
1127668419 15:61171453-61171475 GATGCTGATTCTGCTAATCCAGG + Intronic
1128101599 15:65005392-65005414 GATGCTGATGGGCCTCAGAATGG + Intronic
1128802605 15:70506241-70506263 GATATTGTTGCTCCACATCAGGG - Intergenic
1129596115 15:76965807-76965829 GATGCTGATGCTACGGGTCACGG - Intergenic
1131384131 15:91988727-91988749 GATGCTGATGCTGCTGGTCCAGG + Intronic
1131439949 15:92452199-92452221 GATGCTGATGCTGCTGGTCTGGG - Intronic
1131670056 15:94610341-94610363 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1131767188 15:95691015-95691037 GAAGCTGATGCTGCACATCTAGG - Intergenic
1132089175 15:98933856-98933878 GTTGCTTCTGCACCTCATCAGGG + Intronic
1133658196 16:7887584-7887606 AATGCTACTGCTCTTCATCAAGG - Intergenic
1133726834 16:8545671-8545693 GAGGCTGATGCTGCTGATCTGGG + Intergenic
1133907527 16:10035664-10035686 GATGCTGATGCTGCTGGTCCAGG + Intronic
1134084445 16:11346721-11346743 GATGCTGATGCTGCTGGTCTGGG + Intronic
1134567706 16:15265615-15265637 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134734731 16:16490738-16490760 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1134932742 16:18221168-18221190 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1135046317 16:19158912-19158934 GATGCTGATGCTGCTGGTCCAGG + Intronic
1135463265 16:22663400-22663422 GATGCTCCTGCTCCTTCTCAAGG - Intergenic
1136705327 16:32183302-32183324 GATTATGATGTGCCTCATCATGG - Intergenic
1136762585 16:32746105-32746127 GATTATGATGTGCCTCATCATGG + Intergenic
1136805514 16:33124281-33124303 GATTATGATGTGCCTCATCATGG - Intergenic
1138292552 16:55860358-55860380 GATGCTGATGCTGCTGGTCTAGG - Intronic
1138874564 16:60934103-60934125 GAGTCTGAAGCTCCTCAACATGG + Intergenic
1138909020 16:61374175-61374197 GATCCTGATGGTGATCATCATGG - Intergenic
1139151849 16:64391223-64391245 AATGCTCCTGCTCCTGATCAAGG + Intergenic
1139603370 16:68000464-68000486 GATGCAGATGATCATCATCTGGG - Intronic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140870955 16:79106074-79106096 GATTCTGATGCTGCTGATCCAGG - Intronic
1141813658 16:86393999-86394021 GATGATGATGATGGTCATCATGG - Intergenic
1141991273 16:87611789-87611811 GATGCTGAGGCTGCTGATCTGGG + Intronic
1203064742 16_KI270728v1_random:1006424-1006446 GATTATGATGTGCCTCATCATGG + Intergenic
1142639961 17:1280076-1280098 GATGGAGATACTCCTCACCAAGG + Exonic
1143925469 17:10365525-10365547 GATGCAGATGCTGCTGATCCAGG + Intronic
1144088586 17:11833066-11833088 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144099390 17:11930586-11930608 GATGCTGATGCTGCTGGTCCAGG - Intronic
1144194242 17:12875212-12875234 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144390607 17:14790184-14790206 GATGTTGATGCTGCTTATCTGGG + Intergenic
1144394103 17:14826843-14826865 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1146488015 17:33259898-33259920 GATGCTGATGCTGCTGGTCCTGG + Intronic
1146806358 17:35868102-35868124 GATGCTGATGCTGCTGGTCATGG + Intronic
1147132095 17:38415568-38415590 GAGGCTGAGGGTCCTCATGAAGG + Intergenic
1147279919 17:39350769-39350791 GATGCTGATACTCCTGCTCAGGG - Intronic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1149071379 17:52547555-52547577 GATACTGGTGTTGCTCATCATGG - Intergenic
1149392620 17:56207193-56207215 GATGCTGATGCTGCTGTTCAGGG - Intronic
1149462089 17:56837061-56837083 GATGCTGATGCTGCTGGTCTAGG - Intronic
1149590896 17:57829231-57829253 GATGCTGATTCTGCTCTTCTTGG + Intergenic
1151213028 17:72559040-72559062 GATGCAGATGCTGCTGGTCAGGG - Intergenic
1151737512 17:75953697-75953719 GATGCTGATGCTGCTATTCCAGG - Intronic
1152516923 17:80830727-80830749 GAAAATGATGCTCCCCATCATGG - Intronic
1153555594 18:6310080-6310102 GATGCTGATGCTGCTGGTCCAGG + Intronic
1155764488 18:29610377-29610399 GCTGCTGCTGCTGCTAATCAGGG + Intergenic
1156367182 18:36440168-36440190 GATGCTGATGCTGCTGGTCCAGG + Intronic
1157120021 18:44900639-44900661 GATGCTGATGCTGCTGGTCTGGG - Intronic
1157141447 18:45111169-45111191 GTTGCTGATGCTCCACAAAATGG - Intergenic
1157201430 18:45663221-45663243 GATGCTGATGCTACTGGTCCAGG + Intronic
1157342747 18:46794020-46794042 GATGCTAATGCTGCTCTTCAGGG - Intergenic
1157395983 18:47341551-47341573 GATGCTGAGGCTGCTGATCCAGG + Intergenic
1157710434 18:49846356-49846378 GATGCTGATGCTGCTGGTCCAGG + Intronic
1158015022 18:52774126-52774148 GATGCTGATGCAGCTGATCAGGG - Intronic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1158818047 18:61126745-61126767 GATGCTGATGCTGCTAGACATGG - Intergenic
1158857387 18:61556473-61556495 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1160767700 19:815689-815711 GCTGCTGATGCTGCTCAGCTTGG - Exonic
1162185225 19:8899691-8899713 GATGATGATGATCATGATCATGG - Intronic
1164150580 19:22546939-22546961 GATGCTGATGCTCCCCAGCCAGG - Intergenic
1166633675 19:44430356-44430378 GAAGATGCTGCTCCCCATCAAGG - Exonic
1168427412 19:56249888-56249910 GATGCTGATGCTGCTGGTCTTGG + Intronic
925560538 2:5188590-5188612 GATGCTTATGTTGCTAATCAAGG + Intergenic
925677851 2:6385167-6385189 GATGCTGATGATCCTGAACCTGG - Intergenic
925782148 2:7390880-7390902 GATGCTTATGCTGCTGATCCAGG + Intergenic
926632972 2:15154316-15154338 GTTGCTGAGGCTCTTCATCGGGG + Intergenic
927452275 2:23219331-23219353 GATGCTGATGCTCTTGGTCTGGG - Intergenic
927998942 2:27506555-27506577 GGTGCTGACACTCTTCATCAGGG - Exonic
928230060 2:29490443-29490465 GATGCTGATGCCGCTGATCTAGG - Intronic
929066538 2:37981169-37981191 GATGCTGATGCTTCTGGTCTTGG + Intronic
929375771 2:41284806-41284828 GTGGCTGGTTCTCCTCATCAAGG + Intergenic
930086591 2:47502099-47502121 CATTCTGATGGTCTTCATCAGGG + Intronic
930804741 2:55479160-55479182 GATGCTGATGCTGCTGGTCCAGG + Intergenic
931702265 2:64918715-64918737 GATGCTGACGCTTCTGATCCAGG + Intergenic
931731144 2:65154472-65154494 GATGCTGATGCTGCTGGTCCAGG - Intergenic
932130730 2:69185115-69185137 GATGCTGATGCTGCTGTTCCAGG - Intronic
932132341 2:69199281-69199303 GATGCTGATGCTGCTGGTCTGGG + Intronic
932416744 2:71578199-71578221 GATGCTGATGCTGCTGGTCCAGG + Intronic
932443104 2:71750471-71750493 GATGCTGATGCTGCTGGTCCAGG + Intergenic
932777805 2:74538985-74539007 GCTGCTGCTGCTCCTCCTCTTGG + Intronic
933161280 2:79027107-79027129 GTTACTAATGCTCCTCACCAGGG - Exonic
933656263 2:84889338-84889360 GAAGCTGATGTTCCTAATCTTGG - Intronic
934752564 2:96802937-96802959 GATGCTGGTGCTGCTCCTGATGG - Intronic
934802953 2:97185658-97185680 GATGCTGATGCTGCTGGTCTTGG + Intronic
934833246 2:97554889-97554911 GATGCTGATGCTGCTGGTCTTGG - Intronic
935557492 2:104526257-104526279 GATGCTGATGCTGCTGGTCCAGG + Intergenic
935611676 2:105032174-105032196 AATGCTGATGCTCCTGCTCTGGG + Intergenic
936860992 2:117020450-117020472 GATGCTGTTACTCCCCATCGCGG + Intergenic
936983076 2:118282101-118282123 GATGCTAATGACTCTCATCAAGG - Intergenic
937298087 2:120821813-120821835 GATGCTGAGGCTCTTCACCAGGG + Intronic
937922039 2:127137651-127137673 GATGCTGACGCTCCCTCTCAGGG + Intergenic
939407080 2:141772448-141772470 GATGCTGATGCTGTGGATCAGGG - Intronic
941746762 2:169095197-169095219 GATGCTGATGCTGCTGGTCCAGG - Intronic
942423900 2:175838809-175838831 GATACTGATGCTCTGTATCAGGG - Intergenic
943165842 2:184324717-184324739 GATGCTGATAATGCTCATCCTGG - Intergenic
943598263 2:189883225-189883247 GATGCTAATGCTACTTGTCAGGG + Intronic
944385780 2:199163113-199163135 GATGCTGATGCTACTGATTGAGG + Intergenic
944503242 2:200383158-200383180 GATGCTGAGGCCACTCATCTGGG + Intronic
945145552 2:206734452-206734474 GATGCTGATGCTACTGATCTGGG - Intergenic
945435824 2:209816630-209816652 GATGCTGATGCTGCTGGTCCAGG + Intronic
946398904 2:219458345-219458367 GATGCTGATGCTGCTGGTCTGGG - Intronic
946456465 2:219830631-219830653 GGTGCTGATGCTGCTGCTCAGGG - Intergenic
946736006 2:222755231-222755253 GATGCTGATGCTGCTGCTCTAGG - Intergenic
946854417 2:223939119-223939141 GATGCTGATGCTGCTAGTCCAGG - Intronic
946938449 2:224746129-224746151 GATGCTGATGCTCCTGTTCTAGG - Intergenic
947088778 2:226486344-226486366 GATGCTGATGCTGATAATAATGG + Intergenic
947101776 2:226628786-226628808 GATGTTGATGTTGCTCATCTGGG - Intergenic
947315903 2:228857939-228857961 GATGCTGATGCTCCTGGTCTGGG + Intronic
948160497 2:235819442-235819464 GATGCTGATGCTGCTAATCCAGG + Intronic
1168801482 20:646158-646180 GTTGCTGATGCTGCTGTTCAGGG - Intergenic
1168850202 20:971324-971346 GATGCTGATGCTGCTGGTCCAGG + Intronic
1169270882 20:4198574-4198596 GATGCTGATGCTGCTGTTCAGGG - Intergenic
1169367462 20:5002330-5002352 GATGCTGATGCTACTGGTCTGGG + Intronic
1169509199 20:6245409-6245431 GATGCTGATGCTGCTGTTCCAGG + Intergenic
1169619607 20:7490988-7491010 GATGCTGATGCTACTGATCTGGG - Intergenic
1169698396 20:8418039-8418061 GATGCTGGTGATCTTCACCAGGG - Intronic
1169944581 20:10974990-10975012 GACGGTGATGCTGCTCATCTTGG + Intergenic
1169950935 20:11042435-11042457 GATGCTGATGCTGCTGATCTTGG + Intergenic
1169975110 20:11316492-11316514 GATGCTGATGCTACTGGTGAGGG + Intergenic
1170053578 20:12174270-12174292 GATATTGATGCTGCTGATCAAGG - Intergenic
1170091676 20:12596082-12596104 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1171092861 20:22302585-22302607 GAGGCTGCTGCTCTTCATCTGGG + Intergenic
1171377674 20:24704490-24704512 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1173349522 20:42232464-42232486 GATGCTGATGCTACTGGTCCAGG + Intronic
1173704392 20:45099215-45099237 GATGCTGATGCTGCTGGTCCGGG - Exonic
1174709268 20:52687427-52687449 GATGCTGATGCTCCTGGTCCAGG + Intergenic
1174721990 20:52822638-52822660 GATGCTAATACTACCCATCAGGG + Intergenic
1175547150 20:59785736-59785758 GATGCTGGTGCTGCTGACCACGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1180151588 21:45950879-45950901 GGTGCTGTGGCTCCTCCTCAAGG + Intergenic
1181507147 22:23367072-23367094 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1181868136 22:25875557-25875579 GATGCTGATGCTGCTGGTCTGGG - Intronic
1181913166 22:26256683-26256705 GATGCTGATGCTGCTGGTCCAGG - Intronic
1182050116 22:27306213-27306235 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1183093109 22:35536837-35536859 GATGCTGATGCTGCTGGTCCAGG + Intergenic
949744273 3:7270116-7270138 GATGCTGATGCTGCTGATCTGGG + Intronic
949961711 3:9317772-9317794 GATGCTGATGCTGCTGGTCCAGG + Intronic
950837391 3:15933849-15933871 GATGCTGATGCTGCTGATCAGGG - Intergenic
950918340 3:16667732-16667754 GATGCTGATGCTCCTGGCCTGGG - Intronic
951040279 3:17982020-17982042 GATGCTGATGCTGCTGGTCTAGG + Intronic
951049868 3:18082296-18082318 GATGCTGATGCTGCTGGTCTAGG - Intronic
951133730 3:19078506-19078528 GATGCTGTTGCTGCTGATCTGGG + Intergenic
951526841 3:23661480-23661502 GATACTGATGCTTCTCGTCTAGG + Intergenic
951594676 3:24305177-24305199 GATGCTGATGTTGCTGATCCAGG - Intronic
951641675 3:24843657-24843679 GATGCTGATGCTGCTCATCGGGG - Intergenic
951696803 3:25453573-25453595 GATGCTGATGCTGCTTGTCCAGG + Intronic
952123096 3:30267772-30267794 GATGCTGATGCTGCTGGTCTAGG + Intergenic
952576554 3:34781134-34781156 GATGCTGATGCTGCTGGTCTTGG + Intergenic
952655503 3:35780667-35780689 GATGCTGATGCTTCTTGTCTGGG - Intronic
953344399 3:42163232-42163254 GATCCTGATGCTGCTGGTCAGGG - Intronic
953467172 3:43132411-43132433 GATACTGATGCTGCTGATCTGGG + Intergenic
953497121 3:43397387-43397409 GATCATGATTCTCCTCATCATGG + Intronic
954642944 3:52112908-52112930 GATGCTGATGCTGCTGATCCAGG - Intronic
955350359 3:58189046-58189068 GCTGCTGAGTCTCCTGATCAGGG - Intergenic
955531156 3:59874510-59874532 GATGCTGATGCTGCTGGTCCAGG + Intronic
955783161 3:62507614-62507636 GATGCTGAAGCTGCTGATCCAGG - Intronic
955877747 3:63511186-63511208 AATCCTGATGCTCCTGCTCACGG + Intronic
956362215 3:68460807-68460829 GATGCTGATGCTGCTAGTCTGGG + Intronic
956649878 3:71494774-71494796 GATGCTGATACTACCAATCATGG + Intronic
956650311 3:71498856-71498878 GATACTGATGCTACTGATCCGGG + Intronic
956716214 3:72082413-72082435 GATGCTGATGCTGCTTGTCTAGG - Intergenic
956801594 3:72764650-72764672 GATGCTGCTGCTCCTGGTCCAGG - Intronic
956920102 3:73919108-73919130 GATGCTGATGCTGCTAATTTGGG + Intergenic
957337984 3:78857562-78857584 GATGCTGATGCTGCTGGTCTGGG - Intronic
958894296 3:99813092-99813114 GATGGTAATGCTCCTCATTTTGG + Intergenic
959128811 3:102325383-102325405 GCTGCTGCTGCTGCTCTTCAGGG + Intronic
959324867 3:104924354-104924376 GATGCTGACGCTGCTAATCTGGG - Intergenic
959505689 3:107154105-107154127 GATGCTGATGGTGCTGGTCAAGG - Intergenic
959646819 3:108712790-108712812 GATGCTGATGCTGTTGATCCTGG + Intergenic
960047230 3:113210638-113210660 GATGCTGATGCTGCAGGTCAGGG - Intergenic
960165299 3:114394665-114394687 GATGCTGATGCTACTGGTCTGGG + Intronic
961093570 3:124136378-124136400 GATGCTGATGCTGCTGGTCTGGG + Intronic
961556473 3:127699773-127699795 TCTGCTTATGGTCCTCATCAGGG - Intronic
961860095 3:129909855-129909877 GATGCTGATGCTGCTGTTCCAGG - Intergenic
962002849 3:131317560-131317582 GATACTGCGGCTCCTCATCTGGG - Intronic
962351122 3:134656455-134656477 GATGCTGATCCTGGTCAGCAGGG + Intronic
962417878 3:135200366-135200388 GCTGTTGCTGCTCCTCTTCATGG - Intronic
962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG + Exonic
963704678 3:148671054-148671076 AAAGCTGGTGCTCTTCATCATGG + Intergenic
963924789 3:150939656-150939678 GATGCAGACGCTGCTCATCTGGG + Intronic
964097910 3:152954746-152954768 GATGCTGATTCTGCTGTTCAGGG + Intergenic
964168908 3:153743586-153743608 TATGCTGAAGTTCCACATCAAGG - Intergenic
964339852 3:155697140-155697162 GAGGCTGATACACCTCAACATGG + Intronic
965051904 3:163662201-163662223 GATGCTCAGCCTCCTCACCATGG + Intergenic
966356762 3:179088552-179088574 TATGCTTATCCTCCCCATCAAGG + Intergenic
966755561 3:183368136-183368158 GATGCTGATGCTGCTGGTCTGGG - Intronic
966825873 3:183964559-183964581 GATGCTGATGCTGCTGATCTGGG + Intronic
967113197 3:186313572-186313594 GATGCTGATGCTGCTGGTCCAGG - Intronic
967738550 3:192980313-192980335 GATGCTGATGCTGCTGATCCAGG + Intergenic
967970836 3:194998393-194998415 GATGCTGATGCTGCTGGTCCTGG - Intergenic
968360030 3:198140073-198140095 GCTAGTGATGCTGCTCATCAAGG - Intergenic
968592916 4:1468333-1468355 GATGGTGATGCTACTGATGATGG + Intergenic
968785156 4:2616222-2616244 GATGCTGATGCTGATGATGATGG - Intronic
970384119 4:15538865-15538887 GATGCTGATGCTGCTGATTCTGG - Intronic
970586864 4:17522910-17522932 GATTCTGCTGCTCCTCTTCCTGG + Exonic
971448894 4:26781072-26781094 GATGCTGATGCTGCTTCCCAGGG - Intergenic
972156456 4:36169373-36169395 GAAACTGATGAGCCTCATCAAGG + Intronic
974033259 4:56795182-56795204 GCTGCTGATGCTGCTGGTCAGGG - Intergenic
974436419 4:61862664-61862686 GATGCTAATGCTGCTCGTCCAGG - Intronic
976009430 4:80469113-80469135 GATGCTGATGCTGCTGATTAAGG - Intronic
976038360 4:80852233-80852255 GACGCTGATTCTGCTGATCAAGG - Intronic
976512741 4:85930100-85930122 GCTGCGGTTGCTCCTCACCAAGG - Intronic
977289592 4:95149695-95149717 GCTGCTGCTGTTCCTCATAATGG + Intronic
978634611 4:110789501-110789523 GATACTAATGCTGCTGATCATGG - Intergenic
979011748 4:115379509-115379531 GATATTGATGCTCCTGATCTGGG - Intergenic
979161923 4:117472615-117472637 CATGCTTCTGCTCATCATCAGGG - Intergenic
979193773 4:117895566-117895588 GTTGCTAATGCTCCTCAGCTTGG - Intergenic
979341503 4:119529906-119529928 GATGCTGATGCTGCTGGTCCAGG - Intronic
979559034 4:122081556-122081578 GATGCTGATGCTGCTGATCTGGG - Intergenic
980860564 4:138494911-138494933 GATACTGATTCTGCTCATCTAGG + Intergenic
981246993 4:142552328-142552350 GATGCTGAGGCTGCTAATCTGGG + Intronic
981277679 4:142920923-142920945 GATGCTGATGTTGCTCATTCTGG - Intergenic
982393080 4:154886642-154886664 GAAGCAAATGGTCCTCATCAAGG - Intergenic
983905506 4:173177228-173177250 GATGCTGATGCTGCTGGTCCAGG + Intronic
984126225 4:175814432-175814454 GATGCTGAAGATACTCATAAAGG - Intronic
985165723 4:187092213-187092235 GATGCTGAGCCTGCTCACCAGGG - Intergenic
985570164 5:640526-640548 GCTGCTGCTGCTGCTCAGCAAGG - Exonic
985932329 5:3068230-3068252 GATGCTGATGCTCTCCAGCCAGG - Intergenic
985971192 5:3379862-3379884 GTTTCTCAGGCTCCTCATCATGG - Intergenic
986369516 5:7065924-7065946 GATGCTGAATCTCCTGGTCAAGG - Intergenic
986485614 5:8233206-8233228 GAAGCTGATATTCCTTATCAAGG - Intergenic
986625920 5:9723730-9723752 GATGCTAGTGACCCTCATCAGGG + Intergenic
986771347 5:10976922-10976944 GATGCTGATGCTGCTGGTCTTGG - Intronic
988625126 5:32866697-32866719 GATGCTGATGCTGCTGGTCCAGG + Intergenic
988706880 5:33735313-33735335 GATGCTGATGCTGCTGGTCCGGG + Intronic
989035904 5:37171437-37171459 GATGCTGATACTACTCGTCCAGG + Intronic
990014419 5:51041541-51041563 GGTCTTGATGCACCTCATCATGG - Intergenic
990517352 5:56542592-56542614 GATGCTGATGCTAGTGATCAGGG + Intronic
990522242 5:56591476-56591498 CTTGGAGATGCTCCTCATCAAGG - Intronic
991357035 5:65779265-65779287 GATGCTGATGCTCCTAGCCAGGG + Intronic
992097101 5:73373014-73373036 GATGCTGATGCTTCTTGTCTGGG + Intergenic
992638858 5:78751423-78751445 CATTCTGAGGCTCCTCATGAAGG - Intronic
993776092 5:91998883-91998905 GATGCTGATACTACTGGTCAGGG - Intergenic
994022042 5:95038470-95038492 GGTGTAGATGCTCCTCCTCAAGG + Intronic
995053197 5:107730065-107730087 AATGCTGATGCTGCTCATCAGGG + Intergenic
995385996 5:111589621-111589643 GATGCTGATGCTGCTGGTCTGGG - Intergenic
996172020 5:120305164-120305186 GATGCTGATGCTGCTGGTCTGGG + Intergenic
996588546 5:125119319-125119341 GATGCTGATGCTGCTGGTCTCGG - Intergenic
997074353 5:130654543-130654565 GATGCTTATGCACATCAACAAGG + Intergenic
997257790 5:132442596-132442618 GATGCTGATGCTGCTGGTCTGGG + Intronic
998202221 5:140134147-140134169 GATGCTGATGCTATTGATCTAGG + Intergenic
998946786 5:147348499-147348521 GATGCTGATGCTGCTGATCTGGG + Intronic
999626677 5:153528581-153528603 GATGCTGATGCTGCTGGTCCAGG + Intronic
999720487 5:154395818-154395840 GATGCTAATGCTGCTCGTCCAGG - Intronic
999893188 5:156000898-156000920 GTTGCTGATGCTGCTGATCCAGG + Intronic
1000370527 5:160531495-160531517 GATGCTGATGTTGCTCTTCTTGG + Intergenic
1000836406 5:166160210-166160232 GATGCTGATGCTGCTGATACAGG + Intergenic
1003728056 6:8789335-8789357 CATGCTGATGGTCCTCCTCTTGG - Intergenic
1004171463 6:13298732-13298754 GATGCTGATGCTGCTTGTCCAGG - Intronic
1004758004 6:18634205-18634227 GATGATTATGATCATCATCATGG + Intergenic
1006305257 6:33214774-33214796 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1007034262 6:38658515-38658537 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1007240141 6:40418953-40418975 GATGCTGATGCTGCTGGTCTTGG - Intronic
1007311730 6:40952086-40952108 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1008014683 6:46505055-46505077 GATGTTGATGCTGCTTATCCAGG - Intergenic
1008496407 6:52138457-52138479 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1008670296 6:53761427-53761449 GATGCTGATGCTGCTGGTCTTGG + Intergenic
1010003500 6:70971387-70971409 GATGCTGATGCTGCTAGTCAGGG + Intergenic
1010204303 6:73309148-73309170 GATGCTGATTCTGCTGATCGCGG + Intronic
1010276909 6:73979096-73979118 GATGGTGATGCTGCTGATCCAGG - Intergenic
1012021840 6:93932235-93932257 AAGGCTGATGCACATCATCATGG - Intergenic
1012568095 6:100685441-100685463 GCTGCTGATGCTGCTGATCAGGG - Intronic
1012988297 6:105898463-105898485 GATGCTGATGCTGCTGATCTGGG + Intergenic
1013289237 6:108706507-108706529 GATTGTAATGCACCTCATCAGGG + Intergenic
1013309920 6:108884264-108884286 GATGCTGATGCTGCTGGTCCAGG - Intronic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1014313851 6:119838889-119838911 GATGGTGATGCTAGTCACCAAGG - Intergenic
1015226677 6:130865023-130865045 GAAGCTGATGCTGCTGATCCAGG + Intronic
1017264838 6:152431344-152431366 GATGCTGAGGCTGCTGATCCAGG + Intronic
1017795126 6:157836921-157836943 GATGCTGATGCTGCTGGTCTAGG + Intronic
1019259961 7:76547-76569 GCTAGTGATGCTGCTCATCAAGG + Intergenic
1021114036 7:16728757-16728779 GAGGCTGACGCTGCCCATCAAGG - Intergenic
1021294439 7:18887317-18887339 GATGCTGATACTCCTGATCTAGG + Intronic
1022128498 7:27380467-27380489 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1022216313 7:28265661-28265683 GATGTTGATGCTGCTGATCTAGG + Intergenic
1022242597 7:28527472-28527494 GATGCTGATGCTGCTGGTCTGGG + Intronic
1022429619 7:30303716-30303738 GATGCTGATGCTGCTGGTCTGGG - Intronic
1023044842 7:36201963-36201985 GATGCTGATGCTGCTGGTCCAGG - Intronic
1023325662 7:39052959-39052981 GATGCTGATGCTGCTAATCTGGG - Intronic
1023567653 7:41539548-41539570 GATGCTGATGCTGTTTGTCAAGG - Intergenic
1023576048 7:41628080-41628102 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1023827185 7:44017512-44017534 GATTCTGATGCTGCTTATCTGGG - Intergenic
1024030115 7:45453860-45453882 GATCCTGATGCTCCCCGCCATGG - Intergenic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1026282845 7:68937032-68937054 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1027131374 7:75593658-75593680 TGTGCTTCTGCTCCTCATCAAGG + Intronic
1028140442 7:87268389-87268411 GATGCTGATGCTACTGATGTGGG - Intergenic
1028342321 7:89736526-89736548 CATGCTGATGCTGCTTGTCAAGG + Intergenic
1028694485 7:93692955-93692977 GGTGCAGAAGCTTCTCATCAAGG + Intronic
1029738337 7:102477258-102477280 GATTCTGATGCTGCTTATCTGGG - Intronic
1029755467 7:102570914-102570936 GATTCTGATGCTGCTTATCTGGG - Intronic
1029773416 7:102669994-102670016 GATTCTGATGCTGCTTATCTGGG - Intronic
1030574708 7:111271621-111271643 GATGCTGATGTTGCTGGTCACGG + Intronic
1030799327 7:113829784-113829806 GAAGCTGATGCTTCTCTTTAGGG - Intergenic
1031041368 7:116841772-116841794 GGTGCTGATGCTGCTTGTCAGGG - Intronic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1032609438 7:133396060-133396082 GATGCTGATGCTGCTGGTCTGGG - Intronic
1033157634 7:138970669-138970691 GATGCTGATGCTGCTGATCCGGG + Intronic
1033257713 7:139816581-139816603 GATGCTGATGCTGCTGGTCTGGG - Intronic
1033996600 7:147357412-147357434 GAAGCTGTTGCTCCTCTTCATGG + Intronic
1035933392 8:3809662-3809684 GATGCTGATGCTGCTAATCTGGG + Intronic
1036568912 8:9962425-9962447 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1036730144 8:11255727-11255749 AATGCTGGTTTTCCTCATCAGGG + Intergenic
1039231785 8:35456379-35456401 GATGCTGATGCTGCTGATTAAGG + Intronic
1039420550 8:37434657-37434679 GATGTTGATGCTCCCTAACATGG + Intergenic
1039844856 8:41318789-41318811 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1040419034 8:47221994-47222016 GATGGTGATGATGCTCATGATGG - Intergenic
1042388387 8:68203737-68203759 TACCCTGAGGCTCCTCATCAGGG - Intronic
1042835784 8:73078203-73078225 GATCCTGATGCTGCTGATCCAGG + Intronic
1043379128 8:79684041-79684063 GATGCTTTTGCTCCTCCTCCTGG + Intergenic
1043978204 8:86607537-86607559 GATGCTGATGCTGCTGACCCAGG - Intronic
1044608031 8:94064052-94064074 GATGCTGTTGCTCCTGGTCCAGG - Intergenic
1045565354 8:103309207-103309229 GATGCTGATGCTGCTCACTCAGG + Intronic
1045679067 8:104639590-104639612 GATGCTGATGCTGCTATTCTGGG - Intronic
1045836999 8:106534198-106534220 GATGCTGATGCTGCCAATCCTGG + Intronic
1045894191 8:107194562-107194584 GATGCTAATGCTGCTGGTCAGGG - Intergenic
1046939158 8:119914410-119914432 GATGCTGATGATACTGATTAGGG - Intronic
1047064738 8:121268376-121268398 GATGCTGATGCTGCTTGTCTGGG - Intergenic
1048488435 8:134869840-134869862 GATGCTGATGCTGCTAGTCCGGG - Intergenic
1049916886 9:326559-326581 GATGCTGAAGCTACTGGTCAGGG + Intronic
1049952047 9:654904-654926 GATGGTGATGCTGCTGATCTCGG + Intronic
1050003006 9:1098572-1098594 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1050128542 9:2385477-2385499 TATTCTTATGCTCCTCATCTTGG + Intergenic
1050515595 9:6441052-6441074 GGTGCTGATGCTCCTGGCCAAGG - Intronic
1050516982 9:6454974-6454996 GATGTTGATGCTGCTGATCTTGG + Intronic
1050702739 9:8359210-8359232 GCTGCTGATGCTGCTGGTCATGG - Intronic
1051125579 9:13800865-13800887 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1051237644 9:15018631-15018653 GAAGTTGATGCTCCTGCTCAGGG + Intergenic
1051424307 9:16918291-16918313 GATGATGATGCTGCTCCTCAGGG - Intergenic
1052024453 9:23559070-23559092 GATGCTGATGCTGCTAGTCTAGG + Intergenic
1055296316 9:74837349-74837371 GATGCTGATGCTGCTGGTCCAGG + Intronic
1055715532 9:79113589-79113611 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1055868197 9:80841320-80841342 GATGCTGATGCTGCTGGTCCTGG - Intergenic
1055979916 9:81991338-81991360 GATTCTTGTGCTCGTCATCACGG + Exonic
1056928635 9:90855852-90855874 GATGCTGATGCTGCTGGTCTGGG + Intronic
1057985617 9:99710718-99710740 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1058000176 9:99856837-99856859 GATGCTGATGCTGCTGGTCTGGG + Intronic
1058350417 9:104014886-104014908 GATGCTGATGCTGCTGATCCAGG + Intergenic
1058424271 9:104862807-104862829 GATGCTGATGCTGCTGACCTGGG + Intronic
1058623657 9:106911571-106911593 GATGCTGATGCTGCTGGTCCAGG + Intronic
1058959383 9:109978511-109978533 GACGCAGATGCTCCTTTTCAGGG - Intronic
1059522928 9:114960903-114960925 AATGCTGATGCTGCTTATCTAGG + Intergenic
1059865876 9:118513520-118513542 GGTGCTGAAGCTCCTGTTCAGGG - Intergenic
1060077377 9:120604529-120604551 GAGGCTGATGGTCCTCCTCAGGG - Exonic
1060641249 9:125241081-125241103 GATGCTGCTGCTGCTCAGCGCGG - Exonic
1060838994 9:126779600-126779622 ACTGCTGATGCACCTCCTCATGG + Intergenic
1061039696 9:128132821-128132843 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1061328643 9:129878985-129879007 GGTGCTCATGCTCCACACCAAGG - Intronic
1061648438 9:132026141-132026163 GCTGCTGCTGCTCCTCATTTTGG - Intronic
1062405483 9:136394329-136394351 GATGCTGTGGCTTCTCCTCAGGG - Exonic
1062744736 9:138203914-138203936 GCTAGTGATGCTGCTCATCAAGG - Intergenic
1185721206 X:2383065-2383087 GATGCTGCTGCTGCTGATGATGG - Intronic
1185757847 X:2666241-2666263 GATGTTGATGCTGCTGATCCAGG + Intergenic
1186402155 X:9269872-9269894 GATGCTGATGTTGCTCATCTGGG + Intergenic
1186710678 X:12192821-12192843 GATGCTGATGCTGCTGATCCAGG + Intronic
1186764932 X:12761072-12761094 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1186839343 X:13469522-13469544 GATGCTGATGCTGCTAGTCCAGG + Intergenic
1186882446 X:13879885-13879907 GATGCTGATGTTGCTCGTCCAGG + Intronic
1186996405 X:15128226-15128248 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1187067985 X:15859514-15859536 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1187105647 X:16238790-16238812 GATGCTGATGCTGCTGATCTGGG + Intergenic
1187345776 X:18462352-18462374 GATGCTGATGCTGCTGGTCTGGG - Intronic
1187528597 X:20076138-20076160 GATGCTGATGCTGCTAGTCTAGG + Intronic
1187629460 X:21152848-21152870 GATGCTGATGCTGCTGCTCTTGG + Intergenic
1187707577 X:22023533-22023555 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1188022655 X:25175547-25175569 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1188350677 X:29127375-29127397 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188538721 X:31225752-31225774 GATGCTGATGCTGCTGGTCCAGG + Intronic
1189124035 X:38426442-38426464 GATGCTGATGCTGCTGGTCCAGG + Intronic
1189171752 X:38916242-38916264 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1189198207 X:39169274-39169296 GATGCTGATGCTGCTTCTCAGGG - Intergenic
1189277741 X:39798992-39799014 GATGCTGATGCTGCTCTTCCAGG + Intergenic
1189855990 X:45225518-45225540 GATGCTGATGCTGCTGAACCAGG - Intergenic
1189862893 X:45291593-45291615 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1189943913 X:46157403-46157425 GATGCTGATGCTGCTGGTCCGGG - Intergenic
1190399344 X:50016071-50016093 GATGCTGATGCTGCTAGTCTTGG - Intronic
1190464254 X:50709820-50709842 GATGCTGATGCTACTGGTCCAGG - Intronic
1190827604 X:54031956-54031978 GATGCTGATGCTGCTGGTCCAGG + Intronic
1193349157 X:80438205-80438227 GATGCTAATGCTGCTGGTCAGGG - Intronic
1194872076 X:99144811-99144833 GATGCTGATGCTGCTGATCTAGG + Intergenic
1195369037 X:104155332-104155354 GATGCTGATACTCCTGGACATGG - Intronic
1195762001 X:108256639-108256661 GATGCTGATGCTCCTGGTCCAGG - Intronic
1195961221 X:110388743-110388765 GATGCTGATGCTCCTGGTCCAGG + Intronic
1196111442 X:111951269-111951291 AATGCTGATGCTGCTAGTCAAGG + Intronic
1196363374 X:114894371-114894393 GATGCTTTTGCTCATCATAATGG - Intronic
1198501736 X:137256365-137256387 GATGCTGCTGCTGCTGATCTGGG + Intergenic
1198562068 X:137861147-137861169 GATGCTGATGCTGCTGGTCGGGG + Intergenic
1198651159 X:138865079-138865101 GGTGCTGATGCTGCTGGTCAAGG + Intronic
1198786523 X:140294804-140294826 GATGCTGATGTTGCTAGTCATGG + Intergenic
1199766362 X:150944492-150944514 GATGCTGATGCTGCTGGTCCGGG + Intergenic
1202095172 Y:21242331-21242353 GATGCTGGAGCTGCTCAACATGG - Intergenic