ID: 962775740

View in Genome Browser
Species Human (GRCh38)
Location 3:138657947-138657969
Sequence GGCTATAAACAGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962775740 Original CRISPR GGCTATAAACAGAGGGAGAA GGG (reversed) Intronic
900569693 1:3352188-3352210 GGCCAAACACGGAGGGAGAAGGG - Intronic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
903311484 1:22461256-22461278 GGTTAAAACCAGAGGGAGACTGG + Intronic
904286782 1:29458040-29458062 GGGTAGCAAGAGAGGGAGAATGG - Intergenic
904654793 1:32036651-32036673 GGTTATATATAGAGAGAGAATGG + Intronic
904942139 1:34171307-34171329 GGCTAGTCACAGAAGGAGAAGGG - Intronic
904954237 1:34269691-34269713 GTCTATAAACTAAGGCAGAAGGG + Intergenic
906561798 1:46763697-46763719 GGCTTTACACAGAGGGAGCCTGG - Intronic
907014327 1:50997047-50997069 GTATATAAAGTGAGGGAGAAGGG - Intergenic
909660373 1:78075625-78075647 GGCAAAATACAGAGGAAGAAAGG + Intronic
909901636 1:81144278-81144300 GTCTATAAACAAAAAGAGAATGG - Intergenic
910930984 1:92442297-92442319 GGCCAGACCCAGAGGGAGAAAGG + Intergenic
911183782 1:94883910-94883932 GAATATACACAGAGGAAGAAAGG - Intronic
913260760 1:116996059-116996081 GGCCTTAAAGAGAGGCAGAAAGG - Intergenic
916082891 1:161247072-161247094 GAATATAAACAAATGGAGAATGG - Intergenic
918366551 1:183814099-183814121 GAATAAAAACAGAGGAAGAAAGG + Intronic
920281646 1:204847949-204847971 GGATATAAAGAGAGGGTGGAGGG + Intronic
920440552 1:205977899-205977921 TGCTATAAACAAAGGGAAACAGG - Exonic
922574157 1:226651235-226651257 GGCTGCAGACAGAGGGAGATAGG + Intronic
923032946 1:230264215-230264237 GGCCAGACACAGAGGCAGAATGG - Intronic
923435556 1:233964673-233964695 AGCTACAGACAGAGGGACAAAGG + Intronic
924007775 1:239631044-239631066 GGCGCTAAAGAGAGGAAGAAGGG + Intronic
924351773 1:243121371-243121393 GGCTATAAACATAGACAGACTGG + Intergenic
924632408 1:245753192-245753214 GGCTAGAAACAGAGAGGAAATGG + Intronic
1066121484 10:32292134-32292156 GGGTAAAGAAAGAGGGAGAAAGG - Intronic
1066596188 10:37052567-37052589 GAGAAAAAACAGAGGGAGAAAGG + Intergenic
1069639155 10:69943845-69943867 GGCTGAAAACAATGGGAGAATGG - Intronic
1072447112 10:95508885-95508907 GGCCATAAATAGAGAGACAAAGG + Intronic
1072854189 10:98929284-98929306 GGTTATAAACAGTGGAAAAATGG - Intronic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1074925893 10:118070395-118070417 GGCTATAAACACTGGGAGTCAGG + Intergenic
1075250154 10:120861690-120861712 TGCTCTAAACACAGGGAAAAAGG - Intronic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1077923265 11:6656443-6656465 GGCGAAAGACACAGGGAGAAGGG - Intergenic
1078293427 11:10040019-10040041 TGCTAAAAATAGAGGGAGTATGG + Intronic
1079161101 11:17995052-17995074 TGCTGTATACAGAGGGAGAAAGG + Intronic
1079427292 11:20355922-20355944 GTCTATTAACAGCAGGAGAATGG - Intergenic
1080089848 11:28334167-28334189 GTATATAAAAAGAGGGAGAGTGG - Intergenic
1080870307 11:36230912-36230934 GACTATACACGGAGGGAGAGAGG - Exonic
1081886705 11:46504152-46504174 AGCTATAAAAAGAGGCAGGAAGG + Intronic
1084695648 11:70753507-70753529 AGCTAAAAGCACAGGGAGAAAGG + Intronic
1086831033 11:91563783-91563805 AGCTATAAATAGAAGTAGAAAGG - Intergenic
1087380203 11:97395862-97395884 GACTAAAAAGAGAGGGAGAGAGG - Intergenic
1087599708 11:100297798-100297820 GGCTAAAAACAGTGGGAGGAAGG + Intronic
1088971554 11:114779027-114779049 GGCTACAGAGAGAGGGGGAAAGG - Intergenic
1089129641 11:116201647-116201669 GGCTAAAAGAAGAGAGAGAAGGG - Intergenic
1089310580 11:117555770-117555792 GGCTTTCAGCAGAGGGAGAGAGG + Intronic
1090027842 11:123182898-123182920 GTTTATAAACTGAGGAAGAAAGG - Intronic
1090203286 11:124870791-124870813 GGCAAGAGACTGAGGGAGAAAGG + Intronic
1091472878 12:745155-745177 GACTATTAACAGAGATAGAAAGG - Intergenic
1092403739 12:8200179-8200201 GGCTAGAAACAAAAGCAGAAAGG - Intergenic
1093718758 12:22413790-22413812 GGCTTTACACATAGGAAGAAAGG - Intronic
1094487944 12:30939705-30939727 GGCAAGAAAAAGAGGGCGAAGGG + Intronic
1096977892 12:55709916-55709938 GGCTATAAATAGAGGGGCAAAGG + Intronic
1097027951 12:56072094-56072116 GGCTAGAAATAGGGGGAGATAGG + Intergenic
1097208276 12:57342973-57342995 GGCTATAAAATGAGGGAATAAGG + Intronic
1097275122 12:57807838-57807860 GGAGAGAACCAGAGGGAGAAAGG - Intronic
1100633275 12:96409260-96409282 GGTTAAAAACAGAAAGAGAATGG + Intergenic
1101011458 12:100454751-100454773 GGCTAGGAACAGAGGATGAATGG + Intergenic
1101780361 12:107829520-107829542 GGCTAACAACAGAGGAAGGAAGG - Intergenic
1102675470 12:114655339-114655361 GGCTTTGAAAAGAGTGAGAAAGG - Intergenic
1102928125 12:116842331-116842353 GGCTATGAACACCAGGAGAAGGG + Intronic
1104145319 12:126028064-126028086 AGCTATAAACATAGAGATAAGGG - Intergenic
1105060108 12:133141950-133141972 TGCTATATACAGAGGAATAAGGG + Intronic
1106282336 13:28286690-28286712 GGGTATAAACACAAGGACAAAGG - Intronic
1106695948 13:32172594-32172616 GGCAATGAGCAGATGGAGAAAGG + Intronic
1106973161 13:35170231-35170253 GGCTATAAACAGTGTCAAAATGG + Intronic
1107199009 13:37691051-37691073 GGCTATAATAACAAGGAGAAAGG + Intronic
1107897426 13:44979451-44979473 TGCTATTAATAGAGGGAAAAGGG + Intronic
1108123222 13:47212458-47212480 GGATAGAAACAGAGGGAAGAAGG + Intergenic
1108186135 13:47890325-47890347 GGCTATGAGGAGAGGAAGAAAGG - Intergenic
1108200261 13:48036504-48036526 GCATATTAACAGAGGGAGAAAGG - Intergenic
1109976390 13:69839330-69839352 GGCTTTCAACAGAGACAGAATGG + Intronic
1110917452 13:81040121-81040143 GGCTGGGAACAGAGGGACAAGGG + Intergenic
1111304423 13:86388479-86388501 GGTTATGAACAAAGGGAGAAAGG + Intergenic
1111684742 13:91488102-91488124 GGGTATATACAATGGGAGAAAGG + Intronic
1111889251 13:94061246-94061268 GGATATAAACAGAGTAACAAGGG - Intronic
1112325016 13:98438330-98438352 GGCTATAAAAAGTGGCAGCAAGG - Intronic
1112635182 13:101209164-101209186 GGGTATACACAGAGAGAGAGAGG - Intronic
1112655215 13:101445160-101445182 GGTTCCCAACAGAGGGAGAAAGG - Intergenic
1114517211 14:23307822-23307844 GGTTATAAGCTGAGGCAGAAGGG + Exonic
1114544400 14:23487752-23487774 AGGTATAAAGAGATGGAGAAGGG + Intronic
1114731153 14:24993997-24994019 GGCTATACATAGAGAGAGACTGG - Intronic
1115733343 14:36296202-36296224 GGCTAAAAGCAGATAGAGAAAGG + Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117754899 14:58964737-58964759 GGCGACAAGCAGAGGGAGGAGGG - Intergenic
1118143004 14:63105708-63105730 GGCCGCAAACAGATGGAGAAGGG - Intergenic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1120431077 14:84416812-84416834 AACTGTAAACAGAGGGACAAAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121710763 14:96038041-96038063 GGCTAAAAACAGGGAGGGAAGGG + Intergenic
1121729165 14:96174334-96174356 GGTTGTAGACAGAGGGAGGAAGG + Intergenic
1123974193 15:25537198-25537220 AGCTAAAAACAGAGAAAGAAGGG - Intergenic
1125070140 15:35545268-35545290 ATCTATAAACTGAGGCAGAAGGG - Intronic
1130793919 15:87188301-87188323 GGACACACACAGAGGGAGAAAGG + Intergenic
1132042181 15:98534838-98534860 GACTATAAAAAGAGCCAGAAGGG + Intergenic
1132387471 15:101410644-101410666 GGCCAGAAACAGAAGCAGAAGGG - Intronic
1134820277 16:17241253-17241275 GGCAATAAACAAGGGGAGAGAGG + Intronic
1134861856 16:17567410-17567432 GGAAATATACAGAGTGAGAAAGG - Intergenic
1135522869 16:23190662-23190684 GGCTGTATCCAGAGGGGGAAAGG + Intronic
1135788044 16:25368072-25368094 GGGGACTAACAGAGGGAGAAAGG - Intergenic
1135842379 16:25888353-25888375 AGAGATAAAGAGAGGGAGAAAGG - Intronic
1136467614 16:30455863-30455885 GCCTGTAGAGAGAGGGAGAATGG + Intergenic
1136659635 16:31745981-31746003 GGCTCTAAATAAAGGGATAAAGG - Intronic
1136923327 16:34350059-34350081 GGCTACAAACAGAGGGAATGCGG - Intergenic
1136981246 16:35061747-35061769 GGCTACAAACAGAGGGAATGCGG + Intergenic
1139299876 16:65935781-65935803 GATTAGAGACAGAGGGAGAAGGG - Intergenic
1139377697 16:66510602-66510624 GGCTGTAAATAGAGGTAGCAAGG - Exonic
1141162493 16:81638667-81638689 GGCTATAGAAAGAGGGAAAGAGG - Intronic
1145843026 17:28012277-28012299 GGAGAGAAACTGAGGGAGAAAGG + Intergenic
1146297226 17:31659370-31659392 GGAGAGAAAGAGAGGGAGAAAGG + Intergenic
1148565942 17:48633149-48633171 GGGAACAAACAGAGGAAGAATGG + Intronic
1149340271 17:55678635-55678657 AGATACAAACAGAGGGATAAAGG + Intergenic
1150049546 17:61947755-61947777 GGCAATGAATAGTGGGAGAAAGG + Intronic
1150359122 17:64514990-64515012 CACTATAAACAAAGTGAGAATGG - Intronic
1151871663 17:76840925-76840947 GGGGAGAAACAGAGGGAGAGAGG - Intergenic
1155974642 18:32115819-32115841 GGCTATAAAAAGAGAGGAAAGGG - Intronic
1156704957 18:39869532-39869554 GTCTATAAAAAGAGGGAGAGAGG + Intergenic
1159614104 18:70560327-70560349 GTCTATCAACAGATGGATAAAGG + Intergenic
1160829778 19:1098344-1098366 GGCGAGAAAAAGAGGGAGAAAGG + Intergenic
1163242936 19:16075622-16075644 GGTCAGAACCAGAGGGAGAAAGG + Intronic
1163811357 19:19434357-19434379 GGCTAAAAAGAGCGGCAGAAAGG + Intronic
1164581684 19:29438878-29438900 GGCGATAAAGGGAGGGAGAAGGG + Intergenic
1164889759 19:31813117-31813139 GATTATAAACAGAGGCAGGAAGG + Intergenic
1166012280 19:39951317-39951339 GGCTCCAGACAGAAGGAGAAAGG + Intergenic
1168391242 19:56009663-56009685 GGCAAAACACACAGGGAGAAAGG + Intronic
1168436763 19:56324123-56324145 GGCTATGAATAGAGGGGGAAAGG - Intronic
928427774 2:31192963-31192985 GGCTATAACCACAGGGAAGATGG - Intronic
929235664 2:39603068-39603090 AGCTATAAGTAGAGAGAGAATGG - Intergenic
933092587 2:78138771-78138793 GGCAAGAAAAAGAGAGAGAAGGG - Intergenic
933478754 2:82826238-82826260 GGGTGTATTCAGAGGGAGAAGGG + Intergenic
933627654 2:84619882-84619904 TGCTGTCACCAGAGGGAGAAAGG + Exonic
935580931 2:104755357-104755379 GGCTAGAAGTAGAGGGAGGAGGG + Intergenic
937156765 2:119725288-119725310 GGCTAGGCCCAGAGGGAGAAGGG + Intergenic
937497284 2:122434442-122434464 AGCCATGAACAGAGGGAGATGGG - Intergenic
938732239 2:134155718-134155740 GGCTAGAAACAGAGGGAGGCAGG - Intronic
939011290 2:136848873-136848895 GTCTAAAAACTGAGAGAGAAGGG - Intronic
940254000 2:151709962-151709984 GGCTAAAAACAGAATTAGAAAGG + Intronic
940539432 2:154992463-154992485 GGTTATTAAAAGAGGGATAATGG + Intergenic
941218021 2:162738286-162738308 AGTTATACACAGAGGGAGTAGGG - Intronic
942080150 2:172392802-172392824 GCCTTTAAAAATAGGGAGAATGG + Intergenic
943184720 2:184592968-184592990 GGTTAAAAACAAAGGGAAAAAGG - Intergenic
946360705 2:219218009-219218031 GCCTCTAAGCAAAGGGAGAAGGG - Intronic
948264941 2:236629263-236629285 GGTCAGAAACAGAGGGAGAGGGG - Intergenic
948672252 2:239576032-239576054 GGCTGGAAACAGAGGGAGCTTGG + Intergenic
1173441188 20:43077692-43077714 GGGTATATGCAGAGGGAAAAAGG + Intronic
1174102080 20:48135360-48135382 GGTTATGAACAGAAGCAGAATGG + Intergenic
1176894836 21:14364422-14364444 GGCTGCATACAGAGGAAGAAAGG - Intergenic
1177999512 21:28143941-28143963 AGCTATAACCAGAGGGATTAAGG + Intergenic
1178715548 21:34960793-34960815 GTCTGTAAACACAGGGAGAAGGG + Intronic
1179436833 21:41368190-41368212 GGCTATGCACAGAGGCAGGAGGG - Intronic
1181658823 22:24324926-24324948 AGATATAACCAGAGCGAGAATGG + Intronic
1181970165 22:26683929-26683951 AGCAATAAACAGTGGTAGAAAGG - Intergenic
1182189805 22:28446850-28446872 AGCTATAAACAGTAGGAAAAGGG + Intronic
1182418495 22:30236749-30236771 GGCTAGAAGAAGAGGAAGAAAGG - Intergenic
1183262914 22:36807441-36807463 GGCTAGAATTACAGGGAGAACGG + Intronic
1183322789 22:37175465-37175487 GGCAAAAAGCAGAGGGGGAAAGG + Intergenic
1183463447 22:37967048-37967070 GACTACAAACCCAGGGAGAAGGG - Intronic
1184812292 22:46844390-46844412 GGGTACAATCAGAGGGAGACAGG - Intronic
1184959345 22:47917828-47917850 GGCAGTAAAGAGAGGGAGGAGGG - Intergenic
949339227 3:3010433-3010455 GCCTATAAAGACAGAGAGAATGG - Intronic
950168845 3:10822334-10822356 GTCTCTAAACAGAGGGACATGGG + Intronic
950277179 3:11672015-11672037 GGAGATAAACAAATGGAGAAAGG - Intronic
952215197 3:31271434-31271456 GGCTGCAAGCAGAGGCAGAAAGG + Intergenic
952578052 3:34798528-34798550 GGCTATAAACAATGAGAGAGAGG + Intergenic
952674059 3:36005705-36005727 GGATAGAAAAAGAGGGAGTAGGG - Intergenic
953783557 3:45893460-45893482 GGCAATAGAGAGAGAGAGAAGGG - Intronic
954989119 3:54824110-54824132 AGCTATAATCAGAAGGACAAAGG + Intronic
956571758 3:70704202-70704224 GGCTATAAAAACAGGTAGAGAGG - Intergenic
957811681 3:85229793-85229815 GGCTATGAAGACAGGAAGAAAGG - Intronic
958129174 3:89395751-89395773 GAATAAGAACAGAGGGAGAAGGG - Intronic
958750843 3:98192153-98192175 GGGTAGAGACATAGGGAGAAGGG - Intronic
959184610 3:103030751-103030773 TGCTAGAAACAGAGGTAGAGCGG - Intergenic
960588755 3:119345459-119345481 GGCTTTGAACCGAGGCAGAATGG + Intronic
961432713 3:126894423-126894445 GACATTAAACATAGGGAGAAAGG + Intronic
961866435 3:129956784-129956806 AGCCATAACCAGAGGCAGAAGGG + Intergenic
962775740 3:138657947-138657969 GGCTATAAACAGAGGGAGAAGGG - Intronic
963795563 3:149627697-149627719 GGCTACAAATATAAGGAGAAGGG - Intronic
964754087 3:160078856-160078878 GGTTATAAACAGGTGGATAATGG - Intergenic
964808866 3:160641002-160641024 GGGTATAAATACAGGGACAATGG + Intergenic
964876676 3:161375327-161375349 GGCAATAAAGAAAGGCAGAATGG - Intergenic
965876801 3:173333446-173333468 GGGTATAAACAGAGATAGGAAGG - Intergenic
968190376 3:196662900-196662922 GTCATTGAACAGAGGGAGAAGGG - Intronic
969762314 4:9197603-9197625 GGCTAGAAACAAAAGCAGAAAGG + Intergenic
970139412 4:12965358-12965380 GGGTCAAAGCAGAGGGAGAAAGG + Intergenic
970743757 4:19269581-19269603 TGTTATAAACAGAGTGTGAAAGG - Intergenic
971296695 4:25400271-25400293 GGCTATAAAGAGTGTGAGAGAGG + Intronic
972243424 4:37218999-37219021 TGTTATAAAAAGAGGGAAAAAGG + Intergenic
973128340 4:46617432-46617454 AGCAAAAAACAGAGGGGGAAAGG - Intergenic
975757489 4:77585186-77585208 GGCTTTAAAAATTGGGAGAAAGG + Intronic
975886368 4:78970570-78970592 GGCTATCAACAGAGTGAGTATGG + Intergenic
976782597 4:88777609-88777631 GGCAAGGGACAGAGGGAGAAAGG + Intronic
977621095 4:99137916-99137938 GGGGAAAAAGAGAGGGAGAAGGG - Intronic
978232713 4:106419940-106419962 GGATATCAAAAAAGGGAGAATGG - Intergenic
978693166 4:111540729-111540751 GGGGATAAAAGGAGGGAGAATGG + Intergenic
979378366 4:119977003-119977025 GGCTATAAAAAGATGAAGACAGG + Intergenic
980025495 4:127761121-127761143 GGACAGAAATAGAGGGAGAAAGG - Intronic
980254905 4:130366468-130366490 GGCTTTAACCAGAGGGACAGTGG - Intergenic
980272932 4:130610552-130610574 ATCTATAATCAGAGGAAGAAAGG + Intergenic
981813461 4:148801959-148801981 AGCTATAATAAGAGAGAGAAAGG - Intergenic
985150580 4:186943269-186943291 GACTATAAGCAGAGGAAGAGTGG + Intergenic
987121075 5:14767202-14767224 TACTAAAAACAGAGGCAGAAAGG + Intronic
987700111 5:21386777-21386799 GCCTATAAACACAGGTGGAATGG - Intergenic
990819611 5:59823229-59823251 GGCATTAAACAGGGGGCGAAAGG - Intronic
995420907 5:111965564-111965586 GGATATAGACAGAGGGAAATGGG - Intronic
995848223 5:116517350-116517372 GGATATAAAGTGATGGAGAAAGG + Intronic
995860722 5:116637563-116637585 GGAAATAAACAGAGGCACAAAGG - Intergenic
996365797 5:122699792-122699814 GGATGGAAGCAGAGGGAGAAAGG - Intergenic
997143911 5:131411774-131411796 TGAAATAATCAGAGGGAGAATGG - Intergenic
997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG + Intronic
997692916 5:135839106-135839128 GGGAAGAAACTGAGGGAGAAAGG - Intronic
997733209 5:136195247-136195269 GGCTATAAAATGAGGGGCAATGG + Intergenic
999524464 5:152388769-152388791 GGATAGAAACAGATGGAGATTGG + Intergenic
999731621 5:154479791-154479813 GTCCAAAGACAGAGGGAGAAAGG + Intergenic
1001245816 5:170105334-170105356 GCCTAGAGACAGAGGGAGAGAGG + Intergenic
1002261394 5:177996018-177996040 TGGCATACACAGAGGGAGAAGGG - Exonic
1002799296 6:505757-505779 GGCTATGATGAGAAGGAGAATGG - Intronic
1004287172 6:14332111-14332133 GGCTATATATAGAGAGAGAGAGG - Intergenic
1005524798 6:26635671-26635693 TGCTATAAACAGCAGGATAATGG + Exonic
1005550461 6:26908027-26908049 GCCTATAAACACAGGTGGAATGG + Intergenic
1005891011 6:30137974-30137996 GACTATGAATGGAGGGAGAAAGG - Intronic
1005907281 6:30274535-30274557 TCCTAGAAACAGAGGTAGAACGG + Intergenic
1006508849 6:34510616-34510638 AGATCTAAAAAGAGGGAGAAAGG - Intronic
1006683581 6:35814432-35814454 GGCTGTTAACAGAAGGAGAAGGG + Intronic
1008651255 6:53565326-53565348 GACTATAAAAGGTGGGAGAATGG - Intronic
1009268091 6:61581041-61581063 GGTCTTAAAAAGAGGGAGAAGGG + Intergenic
1010011398 6:71051684-71051706 GGCTATAAAAAGTGGCAGTAAGG + Intergenic
1010143587 6:72639763-72639785 GGGTAAAGAGAGAGGGAGAATGG + Intronic
1012067023 6:94560402-94560424 GGGTATCAACAGAGGTAGAGTGG + Intergenic
1012458311 6:99431099-99431121 GGCAATATAGAGACGGAGAAGGG - Intergenic
1015020642 6:128469835-128469857 GGCTTTAAAGAGAGAGAAAAAGG + Intronic
1016216773 6:141613708-141613730 GTCTATAAACAGAGAGTGAAGGG - Intergenic
1017954253 6:159165363-159165385 TTCTATGAACAGAGGGAAAAGGG - Intergenic
1019111530 6:169720638-169720660 GGCGCTAAATAGAGGGAGAAAGG + Intronic
1022518749 7:30992334-30992356 GACCATAAGGAGAGGGAGAATGG - Intronic
1026426096 7:70295433-70295455 AGATAAAAACAGAGAGAGAACGG - Intronic
1026545200 7:71316283-71316305 GGATCTGATCAGAGGGAGAATGG + Intronic
1027490017 7:78811984-78812006 GGCTATGGTCAGAGGGAGATGGG + Intronic
1027906904 7:84196448-84196470 GGATTTAAAGAGGGGGAGAATGG + Intronic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1029694628 7:102204629-102204651 GGCTATGCAGAGAGGGAGGAGGG + Intronic
1029898081 7:104007585-104007607 GGGGAAAAACTGAGGGAGAAGGG - Intergenic
1032148353 7:129404814-129404836 GACTATAAAAAGTGGGAGAGTGG - Intronic
1033733355 7:144199247-144199269 GGCAAAAAGCAGAGGCAGAAAGG - Intergenic
1033749697 7:144351726-144351748 GGCAAAAAGCAGAGGCAGAAAGG + Intergenic
1033889409 7:145991324-145991346 TGCTTTAAACTGTGGGAGAATGG + Intergenic
1036272400 8:7319349-7319371 GGCTAGAAACAAAAGCAGAAAGG + Intergenic
1036348948 8:7990991-7991013 GGCTAGAAACAAAAGCAGAAAGG - Intergenic
1036786609 8:11692203-11692225 GGCAACAACCAGAGGGAGGAAGG + Intronic
1038468483 8:27789373-27789395 GGCAATAAAAATAGGGAAAAAGG - Intronic
1038995693 8:32920603-32920625 GGTTATAAATAGGGGGTGAAAGG - Intergenic
1039913922 8:41845770-41845792 GGAGAAAAACAGATGGAGAAGGG - Intronic
1046325022 8:112630671-112630693 GGATAAAAAGAGAGGGAGGAAGG + Intronic
1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG + Intergenic
1047473908 8:125206807-125206829 GGCTAAAGAGAGGGGGAGAAAGG + Intronic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1048527065 8:135212974-135212996 GGCTAAAGACAGAGGGAACAGGG - Intergenic
1050595599 9:7201480-7201502 GGAGCTAAACAGAGGGAAAATGG - Intergenic
1051164008 9:14241802-14241824 GTCTATAAGGAGAGGAAGAATGG - Intronic
1051340314 9:16104306-16104328 AGAGAAAAACAGAGGGAGAAGGG - Intergenic
1051784552 9:20728181-20728203 GCCTATAATGAGAGGGAGTATGG - Intronic
1052447910 9:28588173-28588195 TGCTAGAAACAGAGGGGGAATGG - Intronic
1053221425 9:36316177-36316199 GGAGAGAGACAGAGGGAGAAAGG + Intergenic
1055741685 9:79396694-79396716 GCCTATAAACGTAGGGATAATGG - Intergenic
1057681989 9:97196634-97196656 TGCTATAAACAGCAGGATAATGG + Intergenic
1058716552 9:107727504-107727526 GCCTACAATCTGAGGGAGAATGG - Intergenic
1059847963 9:118302652-118302674 GGCTTTAAACAAAGTGAGGAAGG + Intergenic
1060256611 9:122036185-122036207 GGCTATAAAGACACAGAGAAAGG - Intronic
1062742634 9:138187527-138187549 AACTAAAAACAGAGGGAAAAAGG - Intergenic
1203364405 Un_KI270442v1:244099-244121 AGCAATAAACAGAGAGAGGAAGG + Intergenic
1185479218 X:433701-433723 GGCAATGAACAAAGGAAGAAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190154488 X:47977446-47977468 GGCTATAAAGAGTGTGGGAAAGG - Exonic
1190824284 X:54002721-54002743 GGAGATAATCAGAGGAAGAAAGG - Intronic
1192046963 X:67686168-67686190 GACTAGAAAATGAGGGAGAAGGG - Intronic
1192313350 X:70034082-70034104 GGACAAAAGCAGAGGGAGAAAGG - Intronic
1192544615 X:72003370-72003392 GGCTAGGAGCAGAGGGAGATAGG + Intergenic
1192861341 X:75075442-75075464 GGCTATTGACAGAGGAACAAGGG - Exonic
1195579372 X:106483959-106483981 AGCTATAGGCATAGGGAGAAGGG - Intergenic
1196291073 X:113941871-113941893 GGCTAGGAAGAGAGGGAAAAAGG + Intergenic