ID: 962779160

View in Genome Browser
Species Human (GRCh38)
Location 3:138694862-138694884
Sequence GCCTAAACTGCCCCCCCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962779160_962779165 21 Left 962779160 3:138694862-138694884 CCTCCCGGGGGGGCAGTTTAGGC 0: 1
1: 0
2: 0
3: 5
4: 237
Right 962779165 3:138694906-138694928 AGCTGTTTAAAAAATGAAACTGG 0: 1
1: 0
2: 9
3: 74
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962779160 Original CRISPR GCCTAAACTGCCCCCCCGGG AGG (reversed) Exonic