ID: 962780862

View in Genome Browser
Species Human (GRCh38)
Location 3:138715109-138715131
Sequence TCTTTCCTACACATAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962780862_962780865 -6 Left 962780862 3:138715109-138715131 CCCTTCTCTATGTGTAGGAAAGA 0: 1
1: 0
2: 2
3: 21
4: 230
Right 962780865 3:138715126-138715148 GAAAGAATGAATGGATGAGATGG 0: 1
1: 0
2: 24
3: 229
4: 1702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962780862 Original CRISPR TCTTTCCTACACATAGAGAA GGG (reversed) Intronic
900933533 1:5751343-5751365 GCTTTCCTACAGACAGAGGAGGG - Intergenic
901787918 1:11637057-11637079 TCTTTCCTACATGAGGAGAACGG + Intergenic
904376086 1:30083375-30083397 TCTGTCCTGCAGATGGAGAAAGG - Intergenic
910866453 1:91792465-91792487 TCTTTTCTACACATATGTAATGG + Intronic
911252464 1:95592953-95592975 TCTTTCCTGCACTTATAGAAGGG + Intergenic
912240563 1:107903561-107903583 TCTTTGCCACACTTTGAGAATGG - Intronic
913943452 1:125133130-125133152 TCTTTCCTAAACCCAGACAAGGG + Intergenic
915212302 1:154319466-154319488 TATTTCCTACATGTAGCGAATGG + Intergenic
916199389 1:162255815-162255837 TCATTCCTACCCATAAAGACTGG - Intronic
917875407 1:179282464-179282486 TATTTCCTAGACAAAGAAAAAGG + Intergenic
918449745 1:184646991-184647013 TCAGTCCCACACATGGAGAAAGG - Intergenic
919814976 1:201431493-201431515 TCTTTCTTGCACAGAGAGGAGGG - Intergenic
919908546 1:202095556-202095578 GCTTTCCTATGCATAGGGAAGGG - Intergenic
920206838 1:204298473-204298495 TCTTTTCTGCACATGGAGAATGG + Intronic
921139136 1:212288749-212288771 TCTTTCATACACATACTAAAGGG - Intronic
921942080 1:220852504-220852526 TCTTTCCCACACAAACAAAATGG - Intergenic
922654768 1:227372350-227372372 TGCTTCCTACAAATAGAGAGAGG + Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
924603156 1:245509282-245509304 ACTCTCCCAGACATAGAGAACGG - Intronic
1063698563 10:8362101-8362123 TCTCTCCAATACATATAGAAAGG - Intergenic
1063891312 10:10631584-10631606 TCTTTCCCTCACATACAGTAAGG - Intergenic
1064930080 10:20615261-20615283 TCTTTCCTGCAGAGAGAGCATGG - Intergenic
1066179969 10:32951752-32951774 TCTTTCCTCCTCACAGGGAAAGG - Intronic
1066363033 10:34749320-34749342 TGTTTGCTACAAATACAGAAAGG + Intronic
1066778991 10:38922115-38922137 TCTTTCCTAAACACAGACAAGGG + Intergenic
1068365464 10:56044056-56044078 TCTCTCCTACACATAGAAGGAGG - Intergenic
1069574004 10:69513378-69513400 TCTTTCCTTCATGTAGAGATTGG + Intergenic
1069810531 10:71156073-71156095 TCTTGCCTACACATAAAGAATGG - Intergenic
1071204305 10:83255616-83255638 TCTTTCCTAGAACCAGAGAAGGG + Intergenic
1071863310 10:89698644-89698666 TCTTTCATATACATCTAGAATGG - Intergenic
1073040749 10:100603269-100603291 TCATTCCTAAACATTGAGATTGG + Intergenic
1076150562 10:128159171-128159193 GCTTTCCAGAACATAGAGAAAGG - Intergenic
1077795968 11:5492535-5492557 TCTTGCCTTTACACAGAGAAAGG - Intronic
1077973257 11:7218914-7218936 TGTTTCCTAGAAATAGACAAAGG - Intergenic
1079761978 11:24340312-24340334 TTTTTCCTACACTTAGAAAGAGG + Intergenic
1079869940 11:25784639-25784661 ACTTTCCCAAACATTGAGAAGGG + Intergenic
1080919772 11:36697275-36697297 TCTTTCCTAGACCTAGAATAGGG - Intergenic
1081314927 11:41620590-41620612 TCTTTCCTATATATATTGAATGG - Intergenic
1081963824 11:47157512-47157534 ACTTTTCTACACAAAGAGAGGGG + Intronic
1083279904 11:61620520-61620542 GCTTTCAGATACATAGAGAAAGG + Intergenic
1083618518 11:64037679-64037701 TCTTTCCCAGACACAGAGACTGG + Intronic
1085692541 11:78675469-78675491 TTTTTCCTCCACCTTGAGAAAGG - Intronic
1087593259 11:100219906-100219928 TCTTTACTACTCATAGAATAGGG - Intronic
1087879643 11:103400806-103400828 GCTTTTCTACATATACAGAAAGG + Intronic
1091130549 11:133143377-133143399 TCATTCCACCCCATAGAGAATGG - Intronic
1094774571 12:33709749-33709771 ACTTTCCTACACAAACACAAAGG + Intergenic
1094826146 12:34270662-34270684 CCTTTCCTACACATAAAGCTTGG + Intergenic
1095330453 12:40955314-40955336 TCTTTACTACACATAGGGGTGGG + Intronic
1095589089 12:43883738-43883760 TCTTTCATACAAAGAAAGAATGG - Intronic
1099346514 12:81507001-81507023 TCCCTCATACACATACAGAATGG + Intronic
1100519569 12:95360564-95360586 TCTTTTCTTCAAAAAGAGAAAGG + Intergenic
1102627930 12:114251083-114251105 TCTTTCCTAGATTCAGAGAAGGG + Intergenic
1107176259 13:37402653-37402675 TCTTTCCTACACATATCAATAGG + Intergenic
1110758126 13:79200307-79200329 TTTTTCCTACTCTTAGAGCAAGG - Intergenic
1111071775 13:83177659-83177681 TCTTCCCATCACTTAGAGAAAGG + Intergenic
1111576878 13:90166101-90166123 CCATTCCTATACATTGAGAATGG - Intergenic
1112429451 13:99337778-99337800 TCTCCCCTCCACAGAGAGAAGGG - Intronic
1112545969 13:100371177-100371199 TCTTAACAACACATACAGAAAGG - Intronic
1112688071 13:101854985-101855007 TCTTTCCTACACAATGGGAAGGG - Intronic
1117866896 14:60159368-60159390 TCTGTCCAACATATAAAGAAAGG - Intronic
1118099728 14:62583535-62583557 TCTTTCCAAAACTTATAGAATGG - Intergenic
1125058614 15:35391742-35391764 CCTTTCCTACTCAAAGAAAAGGG - Intronic
1125208286 15:37180415-37180437 TCTTTTAAACACATTGAGAAAGG + Intergenic
1126639447 15:50810429-50810451 TCATGCCTGCACATAGAGGATGG - Intergenic
1126971072 15:54112295-54112317 TCTTTCCTGCAGAGAGAGAGGGG + Intronic
1127210871 15:56773272-56773294 TCTTTCCTAATCATAGAAACTGG - Intronic
1128770839 15:70281226-70281248 TATTGCCTACAAATATAGAAAGG + Intergenic
1128788142 15:70413317-70413339 TGTTTCTGACACATGGAGAAGGG - Intergenic
1128853216 15:70983485-70983507 TCTTTCCTACTCATCTGGAATGG + Intronic
1133414656 16:5596927-5596949 TCCTTCCTCAACACAGAGAATGG - Intergenic
1134220578 16:12350669-12350691 TGTTTCCTACAAGTAGGGAATGG + Intronic
1134793537 16:17013213-17013235 TCATTCCTTCACCTAGAGTAAGG + Intergenic
1136770332 16:32832973-32832995 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1136900261 16:34029016-34029038 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1137220690 16:46447383-46447405 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1203072753 16_KI270728v1_random:1095080-1095102 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1144671590 17:17135819-17135841 TCTTTCCTTCACATAGCGTCTGG + Intronic
1145691540 17:26746154-26746176 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1145708290 17:26942791-26942813 TCTTTCCTAAACACAGACAAGGG + Intergenic
1145839642 17:27983739-27983761 TCTTCCCTGCATATTGAGAAGGG + Intergenic
1148631720 17:49115610-49115632 TCTTTCCAAAACATATAGATTGG - Intergenic
1149357310 17:55854503-55854525 CCTATACTACACATAAAGAATGG - Intergenic
1149419758 17:56498201-56498223 ACTTTCTTACATATAGAGTAAGG - Intronic
1203214710 17_KI270730v1_random:111997-112019 TCTTTCCTAAACACAGACAAGGG + Intergenic
1152983560 18:301978-302000 ATTTTCCTACACATATACAATGG - Intergenic
1154038075 18:10825859-10825881 TCTTTCCAAAATATAGAGTATGG - Intronic
1154520608 18:15224778-15224800 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1155083825 18:22435820-22435842 ACTTTCATACACATAGACAGTGG + Intergenic
1155966369 18:32039091-32039113 TCTAACATACACATAGAAAATGG + Intronic
1159755014 18:72353433-72353455 TATTTCCTAAACCTAGAGTATGG + Intergenic
1162321224 19:9971593-9971615 TCATTCATACACTCAGAGAAGGG + Intronic
1164842168 19:31400739-31400761 TCTGACCTACAGATAGAGATAGG + Intergenic
1164994445 19:32709609-32709631 TATTTCCTAGACATTGACAAAGG + Intronic
1166031970 19:40138113-40138135 TCTGTTCTCCACAAAGAGAAGGG + Intergenic
1167555480 19:50192494-50192516 TCTTTCTTTCAAATAGAGATGGG - Intronic
1167864788 19:52315764-52315786 TCCTTCCTACACATAGGGCTTGG + Intronic
1202671179 1_KI270709v1_random:54246-54268 TCTTTCCTAAACCCAGACAAGGG + Intergenic
925345570 2:3169900-3169922 TCTTCCTTACAGAAAGAGAAAGG + Intergenic
927348664 2:22079200-22079222 TCTTTTTTCCACTTAGAGAAAGG + Intergenic
928594492 2:32846943-32846965 TGATGCCAACACATAGAGAAAGG - Intergenic
928938094 2:36701496-36701518 TCTTTCCTTCAGTTCGAGAAAGG + Intronic
929360156 2:41078244-41078266 CTTTTCCTACACATAGAAAAAGG - Intergenic
929919215 2:46160723-46160745 TCTTTTCTGCACTTGGAGAAGGG - Intronic
930113537 2:47699184-47699206 TCTTTCCTAGATTCAGAGAAGGG + Intronic
932734419 2:74244616-74244638 TCTTTCTTAGAAATAGAGACAGG + Intronic
934250228 2:90345987-90346009 TCTTTCCTAAACCCAGACAAGGG - Intergenic
934259337 2:91457429-91457451 TCTTTCCTAAACCCAGACAAGGG + Intergenic
934302628 2:91789298-91789320 TCTTTCCTAAACCCAGACAAGGG + Intergenic
934330627 2:92063468-92063490 TCTTTCCTAAACCCAGACAAGGG - Intergenic
935096224 2:99946712-99946734 TTTTTACTACACATATAAAATGG + Intronic
935141875 2:100360603-100360625 TCTCTCCTGCAGAGAGAGAAAGG + Intergenic
935932094 2:108138319-108138341 TCTGTCCTACACAGAGGGCAAGG - Intergenic
936615974 2:114048158-114048180 TCCTCCCTGCACATAGGGAAGGG + Intergenic
936771565 2:115920097-115920119 TCTTTCCTACAGAGAGAGAGGGG + Intergenic
937125291 2:119471513-119471535 GCCTTCCTCCACATAGAGCAAGG + Intronic
938519959 2:132058556-132058578 TCTTTCCTAAACCCAGACAAGGG - Intergenic
940412946 2:153387751-153387773 TCTTTGGTACACATGGATAAAGG - Intergenic
940850977 2:158688061-158688083 TCATTCCTCAACAAAGAGAAAGG + Intergenic
941548460 2:166884014-166884036 TCTTACCTTCCCATAGAGACTGG + Intergenic
942712887 2:178857596-178857618 TCCTTCTTAAATATAGAGAAGGG - Intronic
943542730 2:189238350-189238372 TCTTTCCTGTACATTGAAAATGG + Intergenic
945199072 2:207263589-207263611 TTTTTCCTTTTCATAGAGAATGG - Intergenic
945393833 2:209298001-209298023 TCTTTCCTTCTCATCTAGAATGG + Intergenic
945736759 2:213610336-213610358 TCTTTCCTACATTAAGAAAAGGG - Intronic
945904014 2:215570448-215570470 TCATTCCAAGACATATAGAAAGG - Intergenic
1169870885 20:10246943-10246965 CCTTTTCTACACATGAAGAATGG - Intronic
1170449088 20:16463160-16463182 TCTTTCCTGCAGACAGAGAGGGG - Intronic
1170744769 20:19089755-19089777 TCTTTCCAATTCCTAGAGAAAGG - Intergenic
1175080807 20:56418879-56418901 TATTTACTACATATGGAGAAAGG - Intronic
1175662164 20:60823062-60823084 TTTTTGCTGCTCATAGAGAAGGG + Intergenic
1175668213 20:60878365-60878387 TCTATGCCACACATAGAGACCGG + Intergenic
1176585046 21:8574999-8575021 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1176776679 21:13141977-13141999 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1177088799 21:16740424-16740446 TATTTACAACACATAGAGAAAGG + Intergenic
1178482503 21:32991747-32991769 TGTTGCCTACACTTTGAGAAAGG + Intergenic
1179267594 21:39818422-39818444 TCTTTCCCTCCCATAGTGAAGGG - Intergenic
1179932807 21:44581933-44581955 TCTTTTCTACAAATATATAAAGG + Intronic
1180267855 22:10551901-10551923 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1180524645 22:16245297-16245319 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1183451219 22:37896336-37896358 TCTTTCCTCTAAATAGAGCAGGG - Intergenic
1203290874 22_KI270735v1_random:37724-37746 TCTTTCCTAAACACAGACAAGGG - Intergenic
1203323715 22_KI270737v1_random:95553-95575 TCTTTCCTAAACCCAGACAAGGG - Intergenic
950117001 3:10457434-10457456 TCTTTCCCACACACAAAGCACGG - Intronic
951578920 3:24141693-24141715 TCTTTACTCCCCATAGAGAAGGG - Intronic
951809879 3:26687191-26687213 TGTTTCCAACACATGTAGAATGG - Intronic
952338012 3:32421478-32421500 GCATTCCAACACACAGAGAAGGG - Intronic
952487048 3:33823309-33823331 TCTTCCCTAAACATAAACAACGG - Intronic
953840223 3:46384094-46384116 TCTTGCCTGCACAGAGAGAGGGG + Intergenic
954914999 3:54141197-54141219 TTTTTCCCCCAAATAGAGAAGGG - Intronic
956956154 3:74343297-74343319 TGTTTGCTGCACATAGAGAGTGG - Intronic
957101857 3:75837665-75837687 TCTTTCCTAGTCAAAGAAAAGGG - Intergenic
958614302 3:96471378-96471400 TTTTAGCTACACATAGAGAATGG + Intergenic
958628176 3:96653695-96653717 TCTTTCCTGCAGAGAGAGAGGGG - Intergenic
958676436 3:97273961-97273983 CCTTTCCTACACATAAAGCTCGG - Intronic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
963492083 3:146015226-146015248 TCATTCTTGCACATGGAGAACGG + Intergenic
963678438 3:148344643-148344665 TCTATCCTCCACTTAGAGACAGG + Intergenic
963713667 3:148777459-148777481 TTTTTTTTACACATAGAAAATGG - Intergenic
967089631 3:186124612-186124634 TCTTTCCTGCCCAGAGAGAAGGG - Intronic
968238211 3:197050788-197050810 TCTTCCCTACACACACAAAATGG + Intronic
970720028 4:18976009-18976031 TCTTTCCTACAAATATAATAAGG + Intergenic
970748653 4:19331344-19331366 TCTTTCCTATACATCTACAACGG - Intergenic
972358171 4:38302159-38302181 TCTTTCCTCCAGATAAAGAGAGG + Intergenic
973142017 4:46781488-46781510 CCTTTCCTACACATACTGAGAGG + Intronic
974067171 4:57089382-57089404 TCTTTCCTTCACAGAAATAATGG - Intronic
975930330 4:79513881-79513903 TCTTTTCTAAACACACAGAAAGG + Intergenic
976491797 4:85679260-85679282 TCTTTCCTAGACCTGGACAAGGG + Intronic
980042726 4:127957586-127957608 TCTTCTTTACACCTAGAGAATGG - Exonic
980406384 4:132357927-132357949 TCTTTTGTCCAGATAGAGAATGG + Intergenic
980684227 4:136204200-136204222 TGTTTCCTTCATATAGAAAATGG + Intergenic
981104626 4:140866433-140866455 CTTTTCCCACACATAGAGAGTGG + Exonic
984140058 4:175994014-175994036 TCTTTCCAAGATAGAGAGAAAGG + Intronic
984453174 4:179929975-179929997 CCATTCCTACATATGGAGAAAGG - Intergenic
984802485 4:183727946-183727968 TCTCTCTCACAAATAGAGAAAGG - Intergenic
986286411 5:6362349-6362371 TCTTTCAGACATATAGAGAAAGG - Intergenic
988829464 5:34973257-34973279 TGCTTCCTACACAGAGACAAAGG + Intergenic
990083946 5:51951970-51951992 TCTTTCCTAGTCAAAGAAAAGGG + Intergenic
991060693 5:62371955-62371977 TCTTTCCTATGCATCCAGAATGG - Intronic
994498989 5:100550438-100550460 TCTTTCTTATACAGAGAAAATGG + Intronic
995234131 5:109806906-109806928 TTTCTCCTAAATATAGAGAAAGG + Intronic
996962062 5:129263063-129263085 TCTCTCCTTCACTTTGAGAAAGG + Intergenic
999403720 5:151287782-151287804 TCTTTCATACATCCAGAGAAAGG + Intronic
1000100348 5:158010414-158010436 TCCTGCCTACACATAGAAGATGG + Intergenic
1000851344 5:166343600-166343622 TCTTTGCTACAAAGAGAGATTGG + Intergenic
1003665490 6:8107744-8107766 TCTGTCCTCCGCATAGAGATAGG - Intergenic
1004036293 6:11927486-11927508 TCTTTTCTACACATTTACAAGGG + Intergenic
1004138598 6:12992743-12992765 TCTCTCCTACAGAGAGAGAGGGG + Intronic
1007291275 6:40788872-40788894 TCTTAGCTTCACAGAGAGAAGGG - Intergenic
1008692350 6:53993705-53993727 TCTTTCCTAAACAAAGATAGTGG + Intronic
1008735619 6:54540101-54540123 CCTTTCCTGCACATGGAGAATGG - Intergenic
1009940755 6:70284999-70285021 TCCTTCCTACCCACAGAGGAAGG + Intronic
1010989989 6:82469746-82469768 TCTTTCCTACTCAAAGAAAGGGG + Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1011296836 6:85835269-85835291 TCTTTCCTAGTCAAAGAAAAGGG - Intergenic
1011436671 6:87345588-87345610 CCTCTCCTACACATACTGAAAGG - Intronic
1012186197 6:96219887-96219909 TTTTTCCTACTCATAAAGTAAGG - Intergenic
1012958423 6:105595820-105595842 TTCTTCCTAAAGATAGAGAAAGG + Intergenic
1015208220 6:130666288-130666310 TCCTTCTTACATACAGAGAAGGG - Intergenic
1019781552 7:2943202-2943224 TCTTTACTAAAAATAGAAAAAGG + Intronic
1021515211 7:21477024-21477046 TGTTTTCTACACCTAAAGAAAGG - Intronic
1022586450 7:31617919-31617941 TCTTTACTACAAATAGAAAAGGG - Intronic
1023235718 7:38084028-38084050 TCTTTCCTAGACTTTGGGAAGGG + Intergenic
1024422544 7:49185810-49185832 TCTTTCCTAGATATAGACAAGGG + Intergenic
1024806058 7:53141472-53141494 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1025479996 7:60970922-60970944 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1025483568 7:61017876-61017898 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1025557772 7:62330534-62330556 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1025564910 7:62422251-62422273 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1025885983 7:65592559-65592581 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1028243071 7:88444497-88444519 TGTTTCCTACATATACAGAGTGG - Intergenic
1028835960 7:95375504-95375526 TCTCTGCCACACATACAGAAAGG + Intronic
1029031859 7:97477018-97477040 TTTTTCCTATACATATAGAATGG - Intergenic
1030551251 7:110963084-110963106 TCTTTTGTACTCATAGAGATGGG - Intronic
1031885536 7:127242453-127242475 TTTTTCCTGAACAAAGAGAAAGG - Intronic
1033075512 7:138246607-138246629 TCTTTCCTAGATCTAGACAAGGG - Intergenic
1033671367 7:143496523-143496545 TTTTTCCTACATGTAGAGATAGG - Intergenic
1034339580 7:150343078-150343100 TCTTTCCTAGAGTTAGACAAGGG - Intergenic
1037659108 8:20912004-20912026 TCTTTCCTGCCCATAGTGATGGG - Intergenic
1037665460 8:20965533-20965555 TGTTTGCTACACAAACAGAAAGG - Intergenic
1039315464 8:36367093-36367115 CTTTTGCTACACACAGAGAAAGG + Intergenic
1039458097 8:37721164-37721186 TCTTTCCTACACTTTCAGAATGG - Intergenic
1040992675 8:53369236-53369258 TCTTTCCTACTCAAAGAAAGGGG + Intergenic
1041629521 8:60070278-60070300 TCTTTCCTATATGTAGTGAAAGG - Intergenic
1041911076 8:63088553-63088575 TCTTTCCTAGATCCAGAGAAGGG + Intergenic
1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG + Intergenic
1045066429 8:98450742-98450764 TCCTTCCTACATGTAGAAAAAGG - Intronic
1048474928 8:134734343-134734365 TCTTTCCTAAAAATAAAGACTGG - Intergenic
1048504298 8:135006763-135006785 TATTTCCTACACATATAAAAAGG + Intergenic
1048945529 8:139443600-139443622 ACTATCCTACATATGGAGAAGGG + Intergenic
1050566133 9:6886119-6886141 TAAGTCCTACACACAGAGAAGGG - Intronic
1053945250 9:43301625-43301647 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1055736518 9:79336530-79336552 TCTTTCCTGGACATAGATCATGG - Intergenic
1056785420 9:89589296-89589318 TCTTTGCTACATATTCAGAAGGG + Intergenic
1056932543 9:90890927-90890949 TCTTTCCTGCAGAGAGACAAGGG + Intronic
1057419804 9:94902200-94902222 TATTTCTTACACACACAGAAAGG + Intronic
1058335982 9:103829525-103829547 TCTTACCTACACTTAAAAAAAGG - Intergenic
1058467307 9:105242515-105242537 TCTTTCCTAGACATAGATAATGG - Intergenic
1059545611 9:115173127-115173149 TCCTTCCTCCACAAACAGAAGGG - Intronic
1061689045 9:132309667-132309689 TCTTTCTTAAATATAGAGATGGG - Intronic
1203580912 Un_KI270746v1:3521-3543 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1203588385 Un_KI270747v1:30203-30225 TCTTTCCTAAACCCAGACAAGGG - Intergenic
1203614952 Un_KI270749v1:52517-52539 TCTTTCCTAAACCCAGACAAGGG + Intergenic
1203655441 Un_KI270752v1:19855-19877 TCTTTTCTACATAAAGAGATAGG + Intergenic
1186279126 X:7973519-7973541 TCTTTCCTGCAGAGAGAGAGGGG - Intergenic
1187073254 X:15909755-15909777 TCTTTCCTAGATGTAGACAAGGG - Intergenic
1187673672 X:21693786-21693808 TCATTCCCAGACATAGAAAAAGG + Intergenic
1188607838 X:32054750-32054772 AATTTCCTTCACATAGAGAAAGG - Intronic
1189684030 X:43545174-43545196 TCTTTCCTAGATACAGACAAGGG + Intergenic
1191082493 X:56528583-56528605 TTTTCTCTTCACATAGAGAAGGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1194576978 X:95625255-95625277 TCCTTCCTTCACATGAAGAAAGG + Intergenic
1196579679 X:117364068-117364090 TATAACCCACACATAGAGAAGGG + Intergenic
1196923259 X:120606120-120606142 TCTTTTTTAGACAAAGAGAAGGG + Exonic
1201522268 Y:14888433-14888455 CCTTTCCTACTCAAAGAAAAAGG - Intergenic