ID: 962781851

View in Genome Browser
Species Human (GRCh38)
Location 3:138726531-138726553
Sequence ACAATACTGTTCAGAGACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962781844_962781851 9 Left 962781844 3:138726499-138726521 CCACTGCCACTGCTACCACCGTT 0: 1
1: 0
2: 6
3: 55
4: 376
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781842_962781851 21 Left 962781842 3:138726487-138726509 CCGCTTCTCCTGCCACTGCCACT 0: 1
1: 0
2: 13
3: 158
4: 1344
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781841_962781851 22 Left 962781841 3:138726486-138726508 CCCGCTTCTCCTGCCACTGCCAC 0: 1
1: 0
2: 7
3: 108
4: 1097
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781840_962781851 23 Left 962781840 3:138726485-138726507 CCCCGCTTCTCCTGCCACTGCCA 0: 1
1: 0
2: 2
3: 37
4: 557
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781845_962781851 3 Left 962781845 3:138726505-138726527 CCACTGCTACCACCGTTGCTATT 0: 1
1: 0
2: 0
3: 10
4: 150
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781843_962781851 13 Left 962781843 3:138726495-138726517 CCTGCCACTGCCACTGCTACCAC 0: 1
1: 1
2: 9
3: 110
4: 617
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781847_962781851 -9 Left 962781847 3:138726517-138726539 CCGTTGCTATTGCCACAATACTG 0: 1
1: 0
2: 3
3: 9
4: 176
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781846_962781851 -6 Left 962781846 3:138726514-138726536 CCACCGTTGCTATTGCCACAATA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
962781839_962781851 28 Left 962781839 3:138726480-138726502 CCTGTCCCCGCTTCTCCTGCCAC 0: 1
1: 0
2: 3
3: 59
4: 618
Right 962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962781851 Original CRISPR ACAATACTGTTCAGAGACCG GGG Intronic
904513945 1:31038393-31038415 AGACTACTGTTCAAAGACCATGG + Intronic
907949206 1:59164685-59164707 GAAATACTGTAGAGAGACCGTGG - Intergenic
910089775 1:83448833-83448855 ACATCACTGTTCAGAGAACTGGG - Intergenic
916357918 1:163934056-163934078 ACAGTACTTTTCTGAGACAGAGG + Intergenic
1070461524 10:76675393-76675415 AAAATCCTGTTCATAGACCCTGG + Intergenic
1078974274 11:16453223-16453245 ACAATACTGTTAAGAAACTAGGG + Intronic
1079284965 11:19120392-19120414 ACTATACTGTGCAGAGGCCCAGG - Intronic
1085574788 11:77592382-77592404 ACAATTCTGTTCATATACAGGGG - Intronic
1088850251 11:113698446-113698468 ACAATGCTGTCCAGAGGCTGGGG - Intronic
1088868549 11:113872234-113872256 AAAATACTGTTTGCAGACCGAGG + Intronic
1093576412 12:20735758-20735780 ACAATACTTCTCAGAGGCAGAGG + Intronic
1096248430 12:50010643-50010665 ACAATACAGGCCAGACACCGTGG + Intronic
1102288902 12:111682922-111682944 ACAATTCAGTTCAGTGACGGGGG - Intronic
1102551409 12:113694746-113694768 ACAAGCCTGTTGAGAGACAGGGG + Intergenic
1104114900 12:125740115-125740137 ACAATGGTTTTCAGAGACTGGGG + Intergenic
1110411390 13:75207449-75207471 ACAAAACTGTTCAAAGAGAGTGG + Intergenic
1113142588 13:107170946-107170968 ACAATACTGGTTTGAGACCATGG - Intronic
1114941774 14:27622065-27622087 CCAAAACTATGCAGAGACCGTGG - Intergenic
1115785043 14:36816227-36816249 ACAGTACTGTTCAGAGAAGTGGG + Intronic
1126368833 15:47924493-47924515 ACAATACTGTGCAGTGCCCCTGG + Intergenic
1128579627 15:68800067-68800089 ACAAGGCTGTTAAGTGACCGTGG + Intronic
1130827498 15:87564741-87564763 AAAATACTGCTCAGAGCCCATGG - Intergenic
1137034806 16:35560796-35560818 AGACTACTGTTCAGAGAATGCGG + Intergenic
1139771568 16:69281093-69281115 AAAATACTGTTAAGAGAATGAGG - Intronic
1140376907 16:74452106-74452128 ACAATACAGGTCAGAGACAATGG - Exonic
1141704891 16:85659309-85659331 CCAATACTGTGCAGAGACCCTGG - Intronic
1146749422 17:35364534-35364556 AAAATGCTGTTCAGACACCTGGG + Intronic
1152442526 17:80317747-80317769 ACACTACTGTCCATAGACGGCGG - Intronic
1152697235 17:81803480-81803502 ACAGGACTGGCCAGAGACCGGGG + Intergenic
1153691759 18:7601195-7601217 ACGAAACTGTTCAGAAACCGCGG - Intronic
1157044172 18:44077818-44077840 ATATTACTGTTTAGAGGCCGAGG - Intergenic
1159789535 18:72760779-72760801 AGAGTACTGTGCAGAGACTGTGG + Intronic
1165967111 19:39591562-39591584 ACCATACTGTTCAGTTACTGTGG - Intergenic
926233733 2:11023912-11023934 ACGATGCTGTTCACAGACCCAGG + Intergenic
927574213 2:24188096-24188118 ACAAAAATGATCAGAGACAGGGG - Intronic
934138058 2:89017167-89017189 ACAATATTGTTCATAGACAGAGG + Intergenic
934231186 2:90183459-90183481 ACAATATTGTTCATAGACAGAGG - Intergenic
942865129 2:180664221-180664243 ACATTGCAGTTCAGAGACTGAGG + Intergenic
947335534 2:229078900-229078922 AAAATACTTTTCAGAGAGTGAGG + Intronic
948093548 2:235315594-235315616 ACTATAATGTACAGAGACAGAGG + Intergenic
1169593181 20:7167887-7167909 ACAATACTTATTAGAGACGGTGG - Intergenic
1170911767 20:20578675-20578697 AAAATTTTTTTCAGAGACCGAGG - Intronic
1172159085 20:32852889-32852911 ACAACACTGATCACAGACTGAGG - Intergenic
1175003603 20:55657808-55657830 ACAAAACTGTTCAGAAACATTGG - Intergenic
1181746126 22:24956057-24956079 AAAATCCTGGTGAGAGACCGCGG + Intronic
951606974 3:24446276-24446298 ACAATTCTTTTCAGAGGCCAAGG - Intronic
956801603 3:72764713-72764735 AGACTCCTGTTCAGAGACCTGGG - Intronic
959709854 3:109374908-109374930 ACAAAACTGTTCGGAGGCCCAGG - Intergenic
962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG + Intronic
965700691 3:171457667-171457689 ACAAGACTGGTCAAAGACCCTGG + Intronic
966436029 3:179885152-179885174 AAAATAGTGTTCTGAGACTGGGG - Intronic
967565961 3:190972419-190972441 ACATTACTGTTCAGAAAGCAAGG - Intergenic
968454502 4:690037-690059 ATAATACTGTTCAGGAAACGGGG - Intergenic
969243919 4:5920161-5920183 ACAATGCTGCACAGATACCGGGG + Intronic
976378082 4:84367460-84367482 ACAATAATGCCCAGAGACAGCGG - Intergenic
976407164 4:84673269-84673291 ACATCACTGTTCAGACACCTTGG - Intronic
977008790 4:91609059-91609081 AACATACTGTTAAGAGACAGTGG - Intergenic
983202578 4:164877458-164877480 ACAATCATGCTCAGAGACCCAGG - Intronic
993075768 5:83228592-83228614 AAAATAATGTTTAGAGACCTGGG - Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1007266026 6:40596526-40596548 ACAATACAGATCAGAAACCCAGG - Intergenic
1007941456 6:45785339-45785361 GCAGTATTGTTCAGAGACCAAGG - Intergenic
1010972141 6:82274260-82274282 ACAATTCTCTCCAGAGCCCGAGG + Intergenic
1014716937 6:124877169-124877191 ACAATATTTTTCAGAGAAGGAGG - Intergenic
1015681335 6:135812069-135812091 ACAAGACTCTTCAGAAACAGTGG + Intergenic
1016756356 6:147691771-147691793 ACAACACTGTTCAGAAATCAAGG + Intronic
1021134789 7:16952248-16952270 ACACTACTGTTCAAAGCCTGAGG + Intergenic
1021589309 7:22243010-22243032 ACAATATTGCTCAGTGACAGTGG + Intronic
1024235833 7:47397047-47397069 ACAACACTAATCAGAGACTGTGG + Intronic
1024332800 7:48173043-48173065 TCAAAACAGTTCAGTGACCGAGG + Intronic
1025985695 7:66449365-66449387 ACATAAATTTTCAGAGACCGAGG + Intergenic
1027306634 7:76905280-76905302 ACATCACTGTTCAGAGAACTGGG - Intergenic
1030336407 7:108332160-108332182 TAAATACTGTACAGAGACCCAGG + Intronic
1031945133 7:127831632-127831654 ACATTACTGAGCAGTGACCGTGG + Intronic
1040349210 8:46546237-46546259 ACAAAACTGTTCAGACTCAGGGG - Intergenic
1048077797 8:131092393-131092415 ACAGTATTGGTCAGAGACCCTGG + Intergenic
1052751222 9:32493239-32493261 AAAATACTATTCACAGACTGTGG + Intronic
1053401828 9:37831509-37831531 ACTGTACTGTTCAGAGACAGGGG + Intronic
1054912254 9:70465395-70465417 ATATTACTGTTCAGAGCCAGAGG - Intergenic
1055587092 9:77766670-77766692 ACAATAGTGTTCAGATGCCTGGG + Intronic
1056429854 9:86516526-86516548 ACACTACTGTTCATGGACAGTGG + Intergenic
1059912359 9:119059469-119059491 AGAAGACTCTTCAGAGACCTTGG + Intergenic
1060374921 9:123109078-123109100 ACAATACAGATCGGAAACCGAGG - Intergenic
1190942462 X:55055723-55055745 ACAATAGTCTTCAGAAACTGAGG - Intergenic
1193839708 X:86394812-86394834 ACAAAACTCTTCAGACACCCTGG - Intronic
1198509409 X:137334554-137334576 ACAATACCTTTCATAGAGCGAGG - Intergenic