ID: 962786147

View in Genome Browser
Species Human (GRCh38)
Location 3:138769871-138769893
Sequence TCTTATCTTTAAAATGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 0, 2: 6, 3: 135, 4: 662}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962786147_962786151 14 Left 962786147 3:138769871-138769893 CCCTACCCATTTTAAAGATAAGA 0: 1
1: 0
2: 6
3: 135
4: 662
Right 962786151 3:138769908-138769930 AGAGTTTAAGTAAATTATCCAGG 0: 1
1: 1
2: 12
3: 97
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962786147 Original CRISPR TCTTATCTTTAAAATGGGTA GGG (reversed) Intronic
900845816 1:5099645-5099667 TGTCATCTTTAAAATGGGAAGGG + Intergenic
901116579 1:6850187-6850209 TGTTATAATTAGAATGGGTATGG - Intronic
901234154 1:7658606-7658628 TCTTATCTGTAAAATGAGTCTGG + Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901761705 1:11476233-11476255 TCTCATCTATAAAGTGGGGATGG - Intergenic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
902259903 1:15217011-15217033 TCTTATCTTTATAGTGGGAAGGG + Intronic
902503194 1:16923975-16923997 ACTTATCTGTAATATGGGTGGGG - Intronic
902610930 1:17596736-17596758 TCTTATCTTTAAAACAGGCTGGG + Intronic
902765163 1:18609496-18609518 TCTCATCTTTAAAAAGGAAATGG - Intergenic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903177178 1:21588082-21588104 TCCTATCTGTAAAATGGGGCCGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903452696 1:23465404-23465426 CTTCATCTTTAAAATGGGAATGG - Intronic
903475137 1:23614316-23614338 CCTTATCTGTAAAATGGGCGTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903763162 1:25713328-25713350 CCTCATCTATAAAGTGGGTATGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
904040603 1:27582304-27582326 CCTTATCTATAAAATTGGGATGG + Intronic
904105793 1:28081669-28081691 TCTTATTTTGAAAAGGGGGAGGG + Intronic
904341038 1:29834787-29834809 CTTTATCTTTAAAATGGGGGAGG + Intergenic
904371095 1:30047799-30047821 TCTTATCTGTAAAGTGGGAGCGG + Intergenic
905032759 1:34898931-34898953 TCTCATCTTTAAAATGGCAATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905815911 1:40950687-40950709 TCTTATCTGTATATTGAGTATGG + Intergenic
906441310 1:45848086-45848108 TCTTATCTATAGAATGTATAGGG + Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
907174243 1:52503068-52503090 TCTTATGTATAAAATGGTTTTGG - Intronic
907257358 1:53190174-53190196 TTTTATCTCTAAAATTGGTGAGG - Intergenic
907263835 1:53242202-53242224 TCTCATCTATAAAATGGGAGTGG + Intergenic
907281814 1:53352460-53352482 TGTTATCTCTAAAATGGGACTGG - Intergenic
907392799 1:54169212-54169234 GCTCATCTATAAAATGGGAATGG - Intronic
907977934 1:59450970-59450992 TCTTATCTTTTAACTGGTTGTGG + Intronic
908186747 1:61659651-61659673 TTTTAACTTGAAAATGGATATGG - Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908738216 1:67299023-67299045 TCTGAAGTTTGAAATGGGTATGG - Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909233264 1:73118891-73118913 TTTTATCTTTAAGAAGGATATGG - Intergenic
909484613 1:76159052-76159074 TCTTGTCCCTAAAATGGGAAAGG - Intronic
910258601 1:85275020-85275042 TATTAGCTGTAAAATGGGAATGG + Intronic
910305736 1:85761195-85761217 TCTTATTTATAAAATGGAGATGG - Intronic
910418703 1:87031253-87031275 TCTTATCTCCAAAATGGGATAGG + Intronic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
910964562 1:92795099-92795121 TCTCAAATTTAAAAAGGGTAGGG + Intergenic
911303115 1:96199736-96199758 TGTTAACTTAAAAATGTGTAGGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
912699976 1:111870513-111870535 TCTTATCTTCAAAATGGCACTGG - Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
914576833 1:148979548-148979570 TTTTATCTTTAAAACCTGTAAGG - Intronic
915632770 1:157164565-157164587 TCTTTTCTGTAAAGTGGGCATGG + Intergenic
916014973 1:160741865-160741887 TCTTATCTGTGAAATGGGATTGG + Intronic
916178914 1:162067269-162067291 TCATTTTTTTAAAATGGGTTTGG + Intergenic
917065049 1:171083678-171083700 TTGTATCTTTCAAATGAGTAGGG - Intergenic
917634936 1:176926191-176926213 CGTTATCTATAAAATGGGGAGGG + Intronic
917696417 1:177529109-177529131 TCTTATCTTTACAGTGGTAAAGG - Intergenic
917742074 1:177970362-177970384 CTTTTTCTTTAAAATGGGAATGG + Intronic
917754671 1:178087434-178087456 GTTTATTTTTAAAATGGGCAGGG + Intergenic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
918073510 1:181151447-181151469 TCTTATCTGTGAAATGGGAATGG + Intergenic
918413051 1:184280751-184280773 GCTTAACTTTAAATTGGGAATGG + Intergenic
918679683 1:187336848-187336870 TTTAATCTTCAAAATGAGTAAGG - Intergenic
919583072 1:199401164-199401186 TTTTATCTTTATATTGTGTATGG - Intergenic
920246488 1:204591503-204591525 TCTAATCTTTAAAATGGGCTGGG + Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920618130 1:207514711-207514733 TCTTATCTCTAAAATATGTTAGG - Intronic
920785123 1:209033943-209033965 TCTTATCTTTTAAAGGTGTGTGG - Intergenic
920878670 1:209860183-209860205 TGCTATCTGTAAAATGGGGATGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921777655 1:219121010-219121032 TCTTAGTTTTAAAATAAGTACGG - Intergenic
922023354 1:221727035-221727057 GCTTGTCTATAAAATGGGGAGGG - Intronic
922224944 1:223637900-223637922 TCTAATCTGTAAAATGAGTTTGG + Intronic
922357446 1:224789776-224789798 TCTCAACTGTAAAATGGGTGTGG - Intergenic
924266069 1:242283838-242283860 TTTTATCTTTCAAATGGAAAAGG - Intronic
924319453 1:242833435-242833457 TCATATATTTAAAAAGAGTAAGG + Intergenic
924458539 1:244237763-244237785 TCTCATCTTTAAGGTGGGTTCGG - Intergenic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
1063068248 10:2631999-2632021 TTTCATCTTGAAAATGGGCAAGG - Intergenic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1064775746 10:18774617-18774639 TCCGATCTATAAAATGGGTGAGG - Intergenic
1064978530 10:21143532-21143554 TCTTACCTTGAAAATGAGTCTGG - Intronic
1065720534 10:28624689-28624711 TTTTTCCTTTAAGATGGGTATGG - Intergenic
1065758728 10:28961111-28961133 TCTAATACTTAAAATGGGGAAGG + Intergenic
1065892813 10:30135553-30135575 TCTGATCTATAAAATGGGCATGG - Intergenic
1066213553 10:33264018-33264040 TCATATTAGTAAAATGGGTATGG + Intronic
1066291222 10:34016110-34016132 TCTCATCTTCAAAATGGTAATGG - Intergenic
1066718764 10:38314699-38314721 TTTTATCTTTCAAATGGAAAAGG + Intergenic
1067920191 10:50447849-50447871 TATTTTCTTTAAAATGACTATGG - Intronic
1068187212 10:53600425-53600447 TCTTATTAATAAAATTGGTAAGG + Intergenic
1068273107 10:54755438-54755460 TCTTATTCTTAAAATGCTTAAGG + Intronic
1068439699 10:57035782-57035804 TTTTATTTTTAAAATGTTTAGGG + Intergenic
1068635603 10:59344673-59344695 TCCTATCTTTAAACTGGAGATGG - Intronic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069608586 10:69757176-69757198 TCCTATCTTCAAAATGGGAGTGG - Intergenic
1069743864 10:70702569-70702591 TCTTATCTGTAAAATGGGACTGG + Intronic
1070644701 10:78193658-78193680 TCTCCTCTTTAAAACGGGCATGG - Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071306234 10:84301086-84301108 TCCTATATTTAAAATGAGGATGG - Intergenic
1071868721 10:89767683-89767705 TCTTCTCTACAACATGGGTATGG - Intronic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1072483160 10:95829009-95829031 TGTTATCTATAAAATGGGCATGG - Intronic
1072575574 10:96696996-96697018 TGTTCTCTTTAAAATGCTTATGG - Intronic
1073276307 10:102314636-102314658 TTTTCTTTTTGAAATGGGTAAGG + Intronic
1074063772 10:109993866-109993888 CCCTATCTGTAAAATGGATATGG - Intergenic
1074102184 10:110362514-110362536 TCTATTCTTTAAAATGAGTTTGG + Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074170513 10:110930004-110930026 TATTATCCTTAAATTGAGTATGG + Intronic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074838834 10:117327787-117327809 TTTTACCTTTGAAATGGATATGG + Intronic
1074899818 10:117806338-117806360 CCTTATCTTTAGAATGGATATGG + Intergenic
1075251910 10:120886337-120886359 TTTTATCTGTAAGATTGGTATGG - Intronic
1076332795 10:129683148-129683170 TCTCTTTTTAAAAATGGGTATGG - Intronic
1077240023 11:1505779-1505801 CCTTATCAGTAAAATGGGCAGGG - Intergenic
1077904716 11:6521521-6521543 TCTTACCTTCAAAATGTTTAGGG + Intronic
1078107038 11:8365082-8365104 TTCTATCTGTAAAATGGGTTGGG - Intergenic
1078577846 11:12516811-12516833 TCTTATCTGTAAAACAGGGATGG - Intronic
1078985930 11:16597417-16597439 TCTAATTTTAAAAATGGGGATGG - Intronic
1079032479 11:16996041-16996063 TCTTTTCTCTATAATGGCTATGG - Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079479667 11:20865998-20866020 TCTTTTCAGTAAAATGGGGATGG + Intronic
1079944803 11:26728675-26728697 ACTCATCTTTAAAATGGAAATGG + Intergenic
1080061317 11:27959840-27959862 TCTTATCTTTAATATGAGGGTGG + Intergenic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080720889 11:34847686-34847708 TCTTATCTAGAAAATGGATGGGG - Intergenic
1081067168 11:38558521-38558543 TCTGATCTTTAAAATTGATATGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1085425878 11:76404251-76404273 TCTTATTTATAAAATGGAGATGG - Exonic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085708843 11:78811134-78811156 CCTTGTCTATAAAATGGGAATGG - Intronic
1085865510 11:80286877-80286899 TTTTATTTTTAAAATGACTATGG - Intergenic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1085931511 11:81088857-81088879 TCTTATCTGTAAAACAGGAATGG + Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086480100 11:87225847-87225869 CCTTATCTTTAAAGTAGGAATGG + Intronic
1086609660 11:88740535-88740557 CCTTATCTTTGAAATGAGTATGG - Intronic
1087259120 11:95991145-95991167 TCTTATCTCTAAAATCAGTTTGG + Intronic
1087591248 11:100190916-100190938 TCTTATATTCAAAAAGGTTAAGG - Intronic
1087624022 11:100575005-100575027 TCTAATTTATAAAATGGGGATGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088063834 11:105690964-105690986 CCTCATCTTTAAAATAGGAAGGG + Intronic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1088466901 11:110149290-110149312 TCTTATCTTTTAAACGGCGAGGG - Intronic
1088739797 11:112757885-112757907 TCTTCTCTGTAAAATGGGAATGG + Intergenic
1090007458 11:123015728-123015750 TCCCATCTTTAAAATGGAGATGG + Intergenic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1092324173 12:7511551-7511573 TCTTGTCTTTAAAATTTGTTAGG - Intergenic
1092331731 12:7591597-7591619 TCTTTTCTTAAATTTGGGTAAGG - Intergenic
1093143680 12:15538902-15538924 TCCTATCTATAAAATGAGTCTGG + Intronic
1093818428 12:23579589-23579611 TCTTAACTATAAAATGGACATGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094742842 12:33309760-33309782 TGATATCTTTAAAAGGGGAAGGG + Intergenic
1095164694 12:38957835-38957857 TCATATCTTTCAAGTGGGAATGG + Intergenic
1095450600 12:42326673-42326695 ACTCATCTTTAGTATGGGTATGG + Intronic
1095734342 12:45540129-45540151 TCCCATCTTTGAAATGGGAAGGG - Intergenic
1096327146 12:50673996-50674018 TCGTATCTTGAAAGTGGGTCAGG - Intronic
1098306373 12:69106855-69106877 TCTTATCTGTGCAATGAGTATGG + Intergenic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098604776 12:72376911-72376933 CCTTATCTGTAAAATGGGATTGG + Intronic
1098720454 12:73891147-73891169 TCTAATCTATAAAATGAGAATGG + Intergenic
1099805795 12:87517572-87517594 TTGTATCTTGAAAATGGGTTTGG - Intergenic
1100041122 12:90318486-90318508 TCTTAATTTTAAAATGAGAATGG - Intergenic
1100271783 12:93032399-93032421 CCTTGTCTATAAAATGGGCATGG - Intergenic
1100363318 12:93897650-93897672 TCTTATCTATAAAATAGAAAAGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1100668139 12:96778001-96778023 TTTTATTTTTAAAATTTGTACGG - Intronic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1100835199 12:98560354-98560376 TATTATCCTTAAAATTGGAAAGG + Intergenic
1101152108 12:101892562-101892584 TTTCATCTTTAAAATGGTAATGG + Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1103079358 12:118011089-118011111 TCACATCTGTAAAATGGGCAGGG - Intergenic
1103248958 12:119483421-119483443 CTTTATCTTTAAAAAGGGAAGGG + Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104848804 12:131861130-131861152 TCTGATCTGTAAACTGGGTGTGG + Intergenic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1107064783 13:36201376-36201398 TTTTAACTTGAAAATAGGTACGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107611717 13:42120628-42120650 TCATATCCTTAATATGGTTATGG - Intronic
1109566757 13:64128007-64128029 TCTTATCTGTAAAAAGGATGTGG + Intergenic
1109613370 13:64795913-64795935 TCTTTCCTTCAAAGTGGGTAAGG + Intergenic
1109874581 13:68383660-68383682 TCTTGTCTCTAAAATGTCTAGGG + Intergenic
1109880966 13:68475960-68475982 TCTTATGTTGAAAATAGATAAGG - Intergenic
1110077478 13:71266093-71266115 TCTAATCAATACAATGGGTAAGG + Intergenic
1110430332 13:75415911-75415933 GCTTTTCTTTAAAATGGCCAAGG - Intronic
1110738873 13:78970817-78970839 ACCTAACTTTGAAATGGGTAAGG - Intergenic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113726796 13:112609757-112609779 TCATATTTTAAAAGTGGGTAGGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114839890 14:26251136-26251158 TCTTATCTATGAAATGGCAATGG - Intergenic
1115083932 14:29490825-29490847 CCTTACCTTTAAAATGTATAAGG - Intergenic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1115638597 14:35315824-35315846 TGTTATTTTTTAAATTGGTAAGG + Intronic
1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG + Intronic
1115979567 14:39035382-39035404 TCTTATATTTAACATGGGAAAGG - Intronic
1117395866 14:55309872-55309894 ATTTATCTTTAGATTGGGTAGGG + Intronic
1117430188 14:55650207-55650229 TATTTTATTTAAAATGGGAAAGG + Intronic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117852257 14:59986819-59986841 CCTTATCTGTAAAATGACTAAGG - Intronic
1118386108 14:65256854-65256876 TCATACCTGTGAAATGGGTATGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119513503 14:75229977-75229999 TCTTATCTTTGAAACAGGCATGG - Intergenic
1119602629 14:75986727-75986749 TTTTATCTTTAAAACTGGTTAGG + Intronic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1120022092 14:79542480-79542502 TCTTGTCTTTAAAATAGATACGG - Intronic
1120033421 14:79668405-79668427 ACGTAACCTTAAAATGGGTATGG - Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120187804 14:81412699-81412721 TCTACTCTTAAAAATGGTTAAGG + Intronic
1120319349 14:82939712-82939734 TCTCATCACTAAAATGGGGATGG + Intergenic
1120442002 14:84553439-84553461 TATTATCTTTAAAATTAGTATGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120719441 14:87874459-87874481 TCTTATCTACAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121859372 14:97302203-97302225 TCTTATCTTTAAAATGAGAGAGG + Intergenic
1121988879 14:98535476-98535498 TCTTATTATTATGATGGGTAGGG - Intergenic
1122834759 14:104425236-104425258 TCTTATCTGGGAAATGGGTGTGG - Intergenic
1122835492 14:104428697-104428719 TCCTCTCTATAAAATGGGAAGGG + Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124884827 15:33675624-33675646 TCTCATCTATAAAATGGACATGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125986571 15:44058915-44058937 TTTTATCTTTTAAATGGCTCTGG + Intronic
1126378802 15:48024641-48024663 TCTTTTCTTCTAAATGGGAAAGG + Intergenic
1126830312 15:52596106-52596128 TTTTATTTTTAATAGGGGTAGGG - Intronic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1127345657 15:58095220-58095242 TCTTATCTATAAAATGGTAATGG - Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128238206 15:66081677-66081699 TCTCATCTTTAAAGTGGGAAGGG - Intronic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128816166 15:70610147-70610169 TCTCATCTGTAAACTGGGTCAGG + Intergenic
1128936055 15:71747360-71747382 TTTCAGCTATAAAATGGGTAGGG - Intronic
1129981026 15:79871175-79871197 TCTTGTCTTTCACAGGGGTAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131230093 15:90653428-90653450 CCTTATCTATCAAATGGGAATGG - Intergenic
1133363242 16:5190560-5190582 TCTTTTATTTAAAATGTATAGGG - Intergenic
1133395421 16:5443206-5443228 TCCTATCTCTAAAATGAGCACGG - Intergenic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133897266 16:9941710-9941732 TCTCATCTATAAAATGGGTGTGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1134492625 16:14706793-14706815 TCTGACCTTTAAAAGGGTTAAGG - Intergenic
1134498006 16:14745915-14745937 TCTGACCTTTAAAAGGGTTAAGG - Intronic
1134582563 16:15383165-15383187 TCTGACCTTTAAAAGGGTTAAGG + Intergenic
1135313886 16:21427229-21427251 TCTGACCTTTAAAAGGGTTAGGG + Intronic
1135366810 16:21859509-21859531 TCTGACCTTTAAAAGGGTTAGGG + Intronic
1135445005 16:22511649-22511671 TCTGACCTTTAAAAGGGTTAGGG - Intronic
1135513081 16:23105037-23105059 TCTTATCATCACAATGGGAAGGG + Intronic
1135514419 16:23118135-23118157 TCTTTTCTGCAAAATGGGAATGG + Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136310550 16:29405932-29405954 TCTGACCTTTAAAAGGGTTAAGG + Intergenic
1136323997 16:29507716-29507738 TCTGACCTTTAAAAGGGTTAGGG + Intergenic
1136438682 16:30247699-30247721 TCTGACCTTTAAAAGGGTTAGGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136616181 16:31399873-31399895 TCATATCTGTAAAATGAGAATGG - Intronic
1137278630 16:46955418-46955440 TCTTATGTTTAAAGTGGTTGTGG + Exonic
1137307632 16:47220029-47220051 TCTTATCTTGCAGATGGGCAAGG + Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137584579 16:49656855-49656877 TCTCATCTATAAAATGGGGCTGG - Intronic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1138922105 16:61543765-61543787 CCATATCTGTAAAATGGGCATGG + Intergenic
1138946447 16:61856738-61856760 GCACATCTGTAAAATGGGTATGG - Intronic
1139074497 16:63427590-63427612 TCTTATCGTTAGACTGGGAATGG - Intergenic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1139858232 16:69998318-69998340 TCTGACCTTTAAAAGGGTTAAGG + Intergenic
1140698005 16:77554185-77554207 TCTTAGCTATAAAATGGAGAAGG - Intergenic
1141302099 16:82826346-82826368 TCTAATTTTTATAATGAGTAGGG + Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143600302 17:7941184-7941206 TTTTATGTATAAAATGTGTAAGG + Intronic
1144391264 17:14795561-14795583 TCTTGTCTGTAAAATGGAAATGG - Intergenic
1144950449 17:18990881-18990903 TCCTGTCTATAAAATGGGAAAGG - Intronic
1145245902 17:21269123-21269145 CCCATTCTTTAAAATGGGTAGGG - Intergenic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1148173328 17:45542705-45542727 TATTATCTGTAAAATGAATAAGG - Intergenic
1148275940 17:46302746-46302768 TATTATCTGTAAAATGAATAAGG + Intronic
1148298054 17:46520320-46520342 TATTATCTGTAAAATGAATAAGG + Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148884557 17:50762402-50762424 TCTTTTTTTTGAAATGGGTCTGG - Intergenic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149437526 17:56645677-56645699 TCTTATATTTAAAATTCATATGG - Intergenic
1149589560 17:57818469-57818491 CATTATCATTAAAATGGGTATGG - Intergenic
1150212348 17:63448033-63448055 CCTGTTCTTTAAAATGGGTTAGG - Intergenic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150404535 17:64889622-64889644 TATTATCTGTAAAATGAATAAGG - Intronic
1151308502 17:73279277-73279299 TCCTATCTCTAAAATGAGCAGGG + Intergenic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1152053851 17:78005773-78005795 TCTCATATTTAAAATGAGAAAGG + Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152996814 18:415213-415235 CCTTATCTGTAAAATGGAAACGG - Intronic
1154238853 18:12633061-12633083 TCTTATCTATAAAATGTTAATGG - Intronic
1154387924 18:13912289-13912311 TCTTATCTATAATATAGGCAGGG - Intronic
1155040268 18:22059489-22059511 CTTTGTCTTTAAAATGGGTGTGG + Intergenic
1156038225 18:32789857-32789879 TCTTATCTTAAAAGTCAGTAAGG - Intergenic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157396701 18:47347496-47347518 CCTCATCTTTATAATGGGAAGGG - Intergenic
1157579954 18:48768202-48768224 TCTTATCTTTTACATAGGAAGGG + Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158755001 18:60312678-60312700 TCTTATCTTGAAAATAGATTGGG + Intergenic
1158777920 18:60608830-60608852 TATTATTTGTAAAATGGGTGAGG - Intergenic
1159077331 18:63696049-63696071 TCTAATGTTTAAAACAGGTAAGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159459417 18:68704926-68704948 TTTCATCTATAAAATGGGAAAGG + Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163567650 19:18060972-18060994 GCCTGTCTTTAAAATGGGAAGGG + Intronic
1164407506 19:27965164-27965186 TCTTATCTGTAAAATGGTGTTGG + Intergenic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
1165925450 19:39323348-39323370 CCTTATCCATAAAATGGGGATGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166516880 19:43453843-43453865 TCTCATCTATAAAATGGCAATGG - Intergenic
1166545244 19:43630585-43630607 TCTCACCTATAAAATGGGAATGG - Intronic
1166625868 19:44355639-44355661 GCTTATCTTTAAAATGGGAATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167688867 19:50973164-50973186 TCTTATCTGTAAAATGGGAGTGG - Intergenic
1167732557 19:51269440-51269462 TGATATATTTAGAATGGGTAAGG + Intergenic
1168030530 19:53676116-53676138 AACTATCTTTAAAATGGGCACGG - Intergenic
1168243390 19:55098242-55098264 CCTTATCTGTCAAATGGGAATGG - Intronic
925839613 2:7979321-7979343 TCTTGTCTGTAAAATAGGAATGG + Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926506856 2:13726823-13726845 TCTTATCTTAGAAATGGTGAAGG + Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927279378 2:21290576-21290598 TCTTATCTTCAGAATAGGCAAGG - Intergenic
927503913 2:23601013-23601035 TCTTCTCTATAAAACGGGAATGG - Intronic
927653732 2:24928394-24928416 TTTCATCTGTAAAATGGATATGG - Intergenic
929019214 2:37533892-37533914 TGTTAACTTTAAAATGTGTAAGG - Intergenic
929395644 2:41519093-41519115 TATTAACATTAAAATAGGTATGG + Intergenic
929491537 2:42401272-42401294 TCTTCTTTTTAAAATGTGTGTGG - Intronic
930450003 2:51523869-51523891 TATATTCTATAAAATGGGTATGG - Intergenic
930729179 2:54710692-54710714 ACTTATCTTTAAAATAGGCATGG - Intergenic
930812387 2:55556756-55556778 TCTTGTTTTAAAAAGGGGTAAGG - Intronic
930849951 2:55950110-55950132 TCTTATTTTTAAAATAAGCATGG - Intergenic
930904071 2:56544940-56544962 TTTTTTATTTAATATGGGTATGG - Intergenic
930936323 2:56956671-56956693 AGTTATCTTTAAAATGGATGAGG + Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931200826 2:60096028-60096050 GCTTATTTTTAAATTGAGTAGGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
932603097 2:73143606-73143628 TCTTGTGTTTAACCTGGGTAGGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
933876704 2:86627061-86627083 TATTATCTATAAAATGGGATAGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935639687 2:105279097-105279119 TCTTATCTTTAAAAATGAGAGGG - Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936719629 2:115235469-115235491 CCTTAGCTTTGAAATGAGTAAGG - Intronic
936834682 2:116694299-116694321 TCTTATCTATGAAAGGGGAAGGG + Intergenic
937561151 2:123225026-123225048 TCTATTCTTTAAAATTGATATGG - Intergenic
937672631 2:124554720-124554742 ACTTCACTTTAAAATGTGTAAGG - Intronic
938547581 2:132348508-132348530 GCTTTTCTTTAAGATGGGAATGG - Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
940144842 2:150534800-150534822 TCTCATCTATAAAATGGGTAGGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941301225 2:163804377-163804399 TCTTATCTGTGAAATGAATAAGG + Intergenic
941864673 2:170322320-170322342 TCTTCTCTTTAAAAGGGCTTTGG - Intronic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
942487274 2:176452763-176452785 TCTTATCTTCAAATTGCCTATGG + Intergenic
942873344 2:180762760-180762782 TCTTGTCTATAAAATGGGAATGG + Intergenic
943201318 2:184829400-184829422 TCTTATATTTAAAATGACAATGG - Intronic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
943600521 2:189914794-189914816 TCTCATCTATAAAATGGGGCAGG - Intronic
944176082 2:196830714-196830736 TCTTTTCTTTAATTTGGATAAGG + Intergenic
945219857 2:207472546-207472568 TCCTATCTTTAAATTTGGGAAGG + Intergenic
945695371 2:213095601-213095623 TTTAATCTTTAAAATGTTTATGG - Intronic
945733991 2:213575142-213575164 TCTTATCTGTAAAGTGAGTGAGG + Intronic
946961703 2:224992370-224992392 TTTTATCTTTAAAATTGATTTGG - Intronic
947418050 2:229918932-229918954 TTTTATCTGTAAAATGGGAGTGG - Intronic
947806553 2:232972615-232972637 TTTGATCTGTAAAATGGGTATGG + Intronic
948515563 2:238501313-238501335 TCTTATCTTTAAAATTAGAAGGG + Intergenic
1168807581 20:681468-681490 TCTTGTCTGTCAAATGGGAATGG + Intergenic
1169499870 20:6148716-6148738 ACTTATATTTACAATGGATATGG + Intergenic
1170740625 20:19052937-19052959 TCTCATCCATAAAATGGGGATGG + Intergenic
1170924417 20:20710029-20710051 TTTGCTCTGTAAAATGGGTATGG - Intronic
1171876448 20:30581264-30581286 GCTTTTCTTTAAGATGGGAATGG - Intergenic
1172425251 20:34851521-34851543 TGCTATCTGTGAAATGGGTAGGG + Intronic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173600504 20:44291668-44291690 TAAAATCTTTAAAAGGGGTAGGG + Intergenic
1173623264 20:44452490-44452512 TATTATCTTTAAAATTAGTATGG - Intronic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG + Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173961428 20:47075376-47075398 TCTTATCTAGAAAAAGGGTGGGG - Intronic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174959281 20:55136750-55136772 TGTTAGCTTTAAAATGGAGATGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175659818 20:60803151-60803173 TCCTATATATAAAATGGGCATGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1177293748 21:19148743-19148765 CTGTATCTTTAAGATGGGTATGG - Intergenic
1177469156 21:21533975-21533997 TCTTAACTATAAAATGATTATGG - Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1179009715 21:37546851-37546873 TCCTATCTATAAAACGGGAATGG - Intergenic
1179593578 21:42427569-42427591 TCAGATCTGTAAAATGGGTAGGG - Intronic
1179672926 21:42962458-42962480 TCTTCTCTTTTAACTGTGTAGGG - Intergenic
1180826102 22:18862935-18862957 TTTCATCTATAAAATGGGCATGG + Intergenic
1181186630 22:21111616-21111638 TTTCATCTATAAAATGGGCATGG - Intergenic
1181212570 22:21298878-21298900 TTTCATCTATAAAATGGGCATGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1181895120 22:26100368-26100390 ACTTACCTTTAAAATGAGCAAGG - Intergenic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182044779 22:27265741-27265763 ACTCATCTTTAAAATGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182318754 22:29464777-29464799 TCTCATCTGTGAAATGGGTGGGG - Intergenic
1182580173 22:31303622-31303644 CTTTATCTGTAAAATGGATAGGG + Intergenic
1182709127 22:32309762-32309784 TCTTATCTGTCAAATGTGTGAGG - Intergenic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183805876 22:40210456-40210478 TCTTTTTCTTAAAATTGGTAAGG + Intronic
1203276244 22_KI270734v1_random:88841-88863 TTTCATCTATAAAATGGGCATGG + Intergenic
949239128 3:1849083-1849105 ACTTATCTATAAAATGGGAGTGG - Intergenic
949370863 3:3333506-3333528 TCTAGTCTTTAAAATGGAAATGG - Intergenic
949866451 3:8551451-8551473 TCTCACCTGTAAAATGGGTTTGG - Intronic
950016055 3:9755922-9755944 TCTTGTCTGTAAAGTGGGTGTGG + Intronic
950228576 3:11256322-11256344 TCTCATGTGTCAAATGGGTAGGG - Intronic
950397235 3:12742871-12742893 CCTTATCTGTATAATGGGTGGGG - Intronic
950398491 3:12752454-12752476 TCTGACCTATAAAATGGGCACGG - Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950650636 3:14404506-14404528 CCTTACCTGTAAAATGGGTGGGG + Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
950771016 3:15311253-15311275 TCTTATCTGTAAACTCGGGATGG - Intronic
951051690 3:18100946-18100968 TCTCATCCTTAAGATGGGAATGG + Intronic
951060962 3:18206840-18206862 TTTTATTTTCAAAATGGGAAAGG + Intronic
951214264 3:20008822-20008844 TCTTATCTGTAAAATGCACAAGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951378536 3:21954092-21954114 TCTTATCTTCCAAATGGGGATGG - Intronic
951464062 3:22982973-22982995 TGATGTCTTTAAAAGGGGTAAGG - Intergenic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
952090783 3:29882814-29882836 TGTTTTCTTTAAAATGTCTATGG + Intronic
952355179 3:32577420-32577442 TTATATTTTTAAAATGGTTAAGG - Intergenic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953074741 3:39558060-39558082 TTTTGTCTTTAAAATAGGTATGG + Intergenic
953295609 3:41712479-41712501 TCATATCTTTAAAATATGAAAGG + Intronic
954808246 3:53232548-53232570 TCCCATCTTTAAAATGGGTGAGG + Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955210994 3:56940874-56940896 TCTTATCTGCAAAATAGGTATGG - Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955842667 3:63128733-63128755 TCTCATCCTTAAAATAGGTTGGG + Intergenic
955959815 3:64328711-64328733 TGTTATCTGTAAAATGGGAAGGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956194430 3:66637731-66637753 TCTCAACTTTAAAATATGTAAGG - Intergenic
956482275 3:69685146-69685168 CCATATCTGTAAAATGGGAATGG + Intergenic
956732855 3:72212962-72212984 TATTATCTATTAAATGTGTATGG + Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957040273 3:75330877-75330899 CCTTATCTTTAAATTGGGCATGG - Intergenic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
957569180 3:81924488-81924510 TCTTATCTACAAATTGGGGAGGG - Intergenic
957920351 3:86739699-86739721 CCTTGTCTTTAAAATGGTTGAGG - Intergenic
957993554 3:87658752-87658774 TCTTATCTTTTTAATTTGTAGGG - Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959301900 3:104613131-104613153 TTTTGTCTTTAAATTGGATAAGG - Intergenic
959308333 3:104697133-104697155 TCTTATTTTTAAGAGGGGTGAGG + Intergenic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959400703 3:105898621-105898643 AATTATCTTTAAAGTGGGGAAGG + Intergenic
959483202 3:106898352-106898374 TACTCTCTTTAAAGTGGGTAGGG - Intergenic
959730563 3:109596719-109596741 TCTTATCCATAATATGGGGATGG + Intergenic
959783932 3:110270321-110270343 TCCTATCCATAAAATGGGTATGG + Intergenic
960963248 3:123087022-123087044 TTTTTTCTTTGAAATGGTTAGGG + Intronic
961028626 3:123583714-123583736 TCTTATTTTAAAAAGGGATAGGG + Intronic
961045068 3:123702457-123702479 CCTTATCTTTAAATTGGGCATGG - Intronic
961054255 3:123774472-123774494 TCTTACCTATAAAATTAGTATGG - Intronic
961070537 3:123919956-123919978 TCTTCTCTTTAAAATGTTCAGGG + Intronic
961190019 3:124952197-124952219 TCTTATCTGTAAAATAGGACTGG + Intronic
961203794 3:125065048-125065070 TCTTATCTGTAAAATATGAACGG + Intergenic
961335886 3:126179618-126179640 TCTTGTCTCTAAAATCGGGAGGG - Intronic
961676642 3:128571574-128571596 TCTATACTTTAAAATGGTTATGG + Intergenic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961931379 3:130537284-130537306 TCTCATCTGTAAAGTGGGTCTGG + Intergenic
962070359 3:132027329-132027351 TCTTATCTGGAAAATGGGAGGGG + Intronic
962517723 3:136169254-136169276 GCTTATTTTTTAAATGGTTACGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963238605 3:142980609-142980631 TGATATCTTTAAAAGTGGTAGGG - Intronic
963478174 3:145833113-145833135 TCTTATTTTTAAAATTGTTTTGG - Intergenic
964159967 3:153635029-153635051 ACTGATCTTTAAAGTAGGTATGG + Intergenic
964277970 3:155028040-155028062 CCTTCTTTTTAAAATGGGAATGG + Intronic
964573931 3:158143313-158143335 TCTTTTCTTTAAAAGTGGAAAGG - Intronic
964687368 3:159412112-159412134 TCTCAGCTGTAAACTGGGTATGG - Intronic
965196286 3:165599988-165600010 TCTGATATTTAAAAAGAGTAAGG - Intergenic
965400458 3:168206818-168206840 TCTCATCTTTAAGATGGGAATGG + Intergenic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
966049474 3:175596433-175596455 TCCTATATTTACAATGGATAAGG - Intronic
966064302 3:175798860-175798882 TCTTATCATTAAATTGAATATGG + Intronic
966474405 3:180326881-180326903 TGTTTTCTTTAAAATGTGAAGGG + Intergenic
966833132 3:184028194-184028216 CCTTATCTCTAAAATTGGGAGGG - Intergenic
967230168 3:187330462-187330484 TCTAATCTTTAAAATGAAAAAGG + Intergenic
967297012 3:187975130-187975152 CCTTTTCTGTAAAATGGGTGGGG - Intergenic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969241909 4:5904528-5904550 CCTTATCTGTAAAATGGGTGTGG - Intronic
969364360 4:6685622-6685644 TCTCATCTGTAAAATGGATGGGG - Intergenic
969943364 4:10757475-10757497 TCTCATCTATAAAATAGGAATGG + Intergenic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970045573 4:11849252-11849274 TCTTATGATTCAAATGGGTACGG - Intergenic
970359612 4:15295726-15295748 TCAGATCTGTAAAATGGGAATGG + Intergenic
970383482 4:15532030-15532052 TCACATCTGTAAAATGGGTATGG - Intronic
970682828 4:18530956-18530978 TCATATCTTAAAAATAGGAAAGG - Intergenic
971181688 4:24334272-24334294 TCTCATCTATAAAATGGGAAAGG - Intergenic
971237408 4:24855141-24855163 TCTTATTTTAAAAATAGTTATGG - Intronic
972064145 4:34918592-34918614 CCTGATGTTTAAAATGGCTATGG + Intergenic
972091642 4:35293644-35293666 TCTTATACTTAATATGGGTCAGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972689874 4:41386377-41386399 TCTTATCTATGAAATGGTTATGG + Intronic
972722804 4:41717608-41717630 TCTTATTTTTAAAAAGGATATGG - Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973536773 4:51890855-51890877 TCTTTTCTCTAAAATAGCTAAGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973786731 4:54339431-54339453 TCTCATCTTTCACATGGGGATGG - Intergenic
973917748 4:55653558-55653580 TCTCATCTATAAAATGTGTATGG - Intergenic
973991200 4:56409170-56409192 GTTTATCTGTAAAATGGGCATGG - Intronic
974021963 4:56699488-56699510 TCTCATCTCTAAAATGAGCATGG - Intergenic
974407543 4:61495056-61495078 TTTTATCTGTGTAATGGGTAGGG - Intronic
975556454 4:75670667-75670689 TTTTGTCTTTAAAATAGATAGGG + Intronic
975997422 4:80332356-80332378 GCTTATTTTTAAAATGGGAAAGG + Intronic
976064785 4:81173056-81173078 TTTTATCTTGAAATTGGTTATGG + Intronic
976519774 4:86013318-86013340 TCTTATAATTAAAATGTGTGTGG + Intergenic
977452483 4:97216637-97216659 TCCTATATATAAAATGTGTAAGG - Intronic
977705854 4:100069150-100069172 TCTTTTCCTTAAGATGGGTATGG - Intergenic
978389413 4:108208661-108208683 TCTTTTCTTTCAAATTAGTATGG + Intergenic
978840928 4:113210632-113210654 GCTTATCTGTAAAACAGGTAAGG + Intronic
980567917 4:134569977-134569999 TCTTTTCTTTAGAGTGGTTAAGG - Intergenic
980683310 4:136192139-136192161 TCTAGCCTTCAAAATGGGTAAGG - Intergenic
980882721 4:138729230-138729252 TCTCATCTTTAAATTTGGAATGG + Intergenic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
982937611 4:161503121-161503143 TATTATCTTTAAATTTGATATGG - Intronic
983380875 4:166991670-166991692 TTTTTTATTTAAAATTGGTATGG - Intronic
983806691 4:172002144-172002166 TATTATATTTAAAGAGGGTAAGG + Intronic
985821381 5:2163195-2163217 TCTCATCTCTAACATGGGGATGG + Intergenic
987072776 5:14353593-14353615 TCTCATCTATAAAATGGGCATGG - Intronic
987227614 5:15859833-15859855 CTTTATCTGTAAAATGGGTCAGG - Intronic
987389188 5:17360222-17360244 TCTTTTCTTTACAAAGGGTAAGG - Intergenic
987579033 5:19764714-19764736 TATTATCTTTTAAAAGGTTATGG + Intronic
989051907 5:37329273-37329295 TCTTGTCATAAAAATAGGTATGG - Exonic
989151377 5:38303050-38303072 TCTTCTCTATGAAATGGGAATGG - Intronic
989288460 5:39732201-39732223 TTTTATCTATAAAAAGGGAATGG + Intergenic
989625518 5:43426059-43426081 TCTGTTCTTTAAACAGGGTAAGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990626014 5:57612351-57612373 TCTAATTTGTAAAATGGGAAGGG - Intergenic
991006850 5:61836434-61836456 TCTCATCTTTAAAATGAGAAAGG + Intergenic
991490188 5:67175163-67175185 TCTCATCTATAAAATGGGAATGG - Intergenic
991595145 5:68296626-68296648 TCTCATCTTTAAAATGGAAGTGG + Intronic
991950506 5:71943015-71943037 TCTTATCTGTAAAATGCATAGGG - Intergenic
991968320 5:72113171-72113193 TTTTATTTCTAAAATTGGTATGG + Intronic
993669652 5:90744812-90744834 TCTTTTTTATTAAATGGGTATGG + Intronic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
993822591 5:92637707-92637729 TCTTTTCTATAAAATGGGATAGG + Intergenic
993993697 5:94692331-94692353 TTTTATGTTTAAAATCTGTAAGG + Intronic
994003061 5:94804315-94804337 TCTTACCTATAAAATGGAGATGG + Intronic
994127249 5:96181976-96181998 TCATTTCTATAAAATGGATAAGG + Intergenic
994803095 5:104405047-104405069 ATTTATATTTAAAATGTGTAAGG + Intergenic
994939372 5:106301813-106301835 TCATATCATTAAAACGGGAATGG + Intergenic
995000328 5:107120006-107120028 TCTCATTTTAAAAATGGGAATGG - Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
995597540 5:113764078-113764100 TCTCAACTTTGAAGTGGGTAAGG - Intergenic
995658095 5:114449751-114449773 TCTTATCTCTTAAATCTGTAAGG - Intronic
995694108 5:114860484-114860506 TCTTAATTTTAGGATGGGTATGG - Intergenic
996124933 5:119713605-119713627 TATTATCTTGGAGATGGGTAGGG + Intergenic
996240421 5:121193350-121193372 TCTTAACATTTAAATAGGTATGG - Intergenic
996815103 5:127565805-127565827 TCTCATCTACAAAGTGGGTATGG - Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997423425 5:133786898-133786920 TCTTATCTGTGAAATGAGAATGG - Intergenic
997859244 5:137401413-137401435 TCTCATCTTAAAGCTGGGTATGG + Intronic
997880213 5:137582615-137582637 TCTCATCTATAAAATGGGAATGG - Intronic
998158714 5:139800902-139800924 TTTTATCTTAAAAATGGTTCTGG + Intronic
998377691 5:141702168-141702190 TCTTAGCTGTAAAATGGGCACGG + Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999111744 5:149127348-149127370 CCTCATCTCTAAAATGGGTTTGG - Intergenic
999276133 5:150331287-150331309 TCTTATCTGTAAACAGAGTAGGG - Intronic
999343643 5:150795803-150795825 CCTTATCTTTCAAATGGGGATGG + Exonic
999453154 5:151693685-151693707 ACTCATCTTTAAAATGAGAATGG - Intergenic
999768781 5:154758991-154759013 TCTTATACTTAAAAGGGGTATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000961777 5:167609205-167609227 TGTTATCTGTACAATGGGTATGG - Intronic
1001019115 5:168167810-168167832 TCTTATCTGTAAAATAGGCATGG + Intronic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001916447 5:175564981-175565003 TCATATCATTAAACTGAGTAAGG + Intergenic
1002122085 5:177012823-177012845 TCTTACCTTAAAAATCAGTAAGG + Intronic
1002449269 5:179309836-179309858 TCTTCTATTTAAAATGCATAGGG + Intronic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1003343488 6:5243961-5243983 TCTTATTTTTTAAAAGGGAAAGG + Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1004533319 6:16475071-16475093 TCTCATCTATAAAAGGAGTAGGG - Intronic
1005663713 6:28027059-28027081 TCTTATCTGTGAAATAGGCATGG - Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006439262 6:34043056-34043078 TCTTGTCTTTAAAATGGCAGCGG - Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1007196689 6:40067373-40067395 TCATATCTTTAACATGTGTAAGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1009750735 6:67876259-67876281 TCTTATTTTTAAAATGAGACAGG - Intergenic
1009831488 6:68942313-68942335 TTTTTTCTTTAACATTGGTAAGG - Intronic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1010090800 6:71979072-71979094 TATTATCATTAAAATAGCTATGG - Intronic
1010329327 6:74604311-74604333 TCTTATCTGGAAAATGTGTGTGG + Intergenic
1010762259 6:79736954-79736976 TAATATTTTTAAAATGGATAAGG + Intergenic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1011184482 6:84659059-84659081 CCTTACCTTTAAAATATGTATGG + Intergenic
1011274030 6:85610968-85610990 ACTTATCTACAAAATGAGTATGG - Intronic
1011472111 6:87718260-87718282 CCTTATCTTTGAAATAGGGATGG + Intergenic
1012251998 6:96990824-96990846 TCTTCTCTTTAAGATGGCTGTGG + Intronic
1012394820 6:98784470-98784492 TCTTATCTATAAGATGGGGGTGG - Intergenic
1012558804 6:100552045-100552067 TCTTATCTTAAATTTGGGTTTGG + Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012952317 6:105531480-105531502 TCTCATCTATAAAATGGGAATGG - Intergenic
1013193852 6:107828088-107828110 CCTTATCTGTAAGATGGGAATGG - Intergenic
1013582209 6:111546708-111546730 TTTTAACTTTAAAACAGGTAAGG - Intergenic
1013859860 6:114622784-114622806 TCTTAGCTTTGGCATGGGTATGG + Intergenic
1014445512 6:121522827-121522849 TCTTAAACTTAAAATGTGTATGG - Intergenic
1014631986 6:123799757-123799779 TCTTATTTATAAAATGGGAGGGG - Intergenic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1015780164 6:136857137-136857159 TCTTGTCTCTGAAATGGCTAAGG - Intronic
1016472887 6:144393333-144393355 TCTCAACTTTAAAATGTGCATGG + Intronic
1016722510 6:147318448-147318470 TATTACCTTTAAAATGGATTTGG - Intronic
1017538016 6:155369495-155369517 TTTAATCATTAAAATGGGAATGG - Intergenic
1017676099 6:156815477-156815499 TGTTATTTTAAAAATGGGTGTGG - Intronic
1018071869 6:160171800-160171822 TCATATTTATAAAATGGGGAGGG + Intronic
1018106234 6:160489696-160489718 TCTTAACTTTTAACTGGATAGGG + Intergenic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1020032609 7:4943466-4943488 TCTCTTCTGTGAAATGGGTAGGG - Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021612401 7:22471025-22471047 TTTCATCTTTAAATTGAGTAAGG + Intronic
1021659029 7:22899790-22899812 CCTTCTTTTTAAAATGGGAAAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022482142 7:30751369-30751391 TCTTCTCTTTGAAATGGGACTGG - Intronic
1023123539 7:36933404-36933426 TCTTATCTTGGAACTTGGTATGG + Intronic
1023320309 7:38989891-38989913 TCATATCTTTAAAATGCTGATGG + Intronic
1023375306 7:39549852-39549874 CCTTATCTATAAAATGGAGAGGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024867830 7:53924079-53924101 TCTTATCTTTTAAGTGGCTTTGG + Intergenic
1024944133 7:54792188-54792210 ACTTATTTTTAAAATTCGTATGG + Intergenic
1025828291 7:65028620-65028642 TCTTCTCCATAAAATGGGGATGG - Intergenic
1025915817 7:65865053-65865075 TCTTCTCCATAAAATGGGGATGG - Intergenic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026193728 7:68153683-68153705 TTTTATCTTTAAAACTGATATGG + Intergenic
1026865877 7:73823731-73823753 TCTCATCTCTAAGATGGGAATGG + Intronic
1027957742 7:84903113-84903135 TCTTGGTTTTAAAATGGGAAGGG - Intergenic
1028486274 7:91361016-91361038 TATTATCTTCAAAATGCTTAGGG + Intergenic
1028566534 7:92238842-92238864 TCACATCTATAAAATGGGAATGG - Intronic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1029605255 7:101595079-101595101 TCTCATCTATAAAATGGGCCCGG - Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1032160818 7:129508942-129508964 TTTAATCTTTAAAATGGTTTGGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033673464 7:143514814-143514836 CCTCATCTATAACATGGGTATGG - Intergenic
1034389171 7:150770134-150770156 TCTACTCCTTAAACTGGGTATGG + Intergenic
1035468058 7:159092501-159092523 TCTTCAGTTTAAAATGGGAAAGG - Intronic
1036988278 8:13561804-13561826 TCCAATTTTAAAAATGGGTAAGG + Intergenic
1038467045 8:27773933-27773955 TATTATTTGTAAAATGGGAATGG + Intronic
1038664676 8:29527983-29528005 TCTTATCTGTAAAGTGGGAAAGG + Intergenic
1039126916 8:34213904-34213926 TCTCATCCTTAAAATGGAAAAGG - Intergenic
1040742070 8:50588259-50588281 AATTATCTTTAAAATGGATGTGG + Intronic
1041459088 8:58091898-58091920 TCATTTCTTTAAAACTGGTATGG - Intronic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1042125565 8:65534371-65534393 TCTTATGTCTAAAATGAGAATGG - Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043813906 8:84777954-84777976 TCTTATCTGTAAAATGCGAGAGG + Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045239046 8:100382407-100382429 ACTTTTCTTTAAAATGGTAAGGG + Intronic
1045552829 8:103187710-103187732 GCTTATCTTCACACTGGGTAAGG + Intronic
1045560261 8:103254815-103254837 TGTTTTCTTTAAAATGGCTGGGG + Intergenic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045811442 8:106224505-106224527 TTTTATCTTTAAATTGGGGCAGG + Intergenic
1046437897 8:114217509-114217531 TCTTATTTTTAAAAAGGAAACGG + Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047307632 8:123665948-123665970 TCTTTGCTTTAAAATGAGTCTGG + Intergenic
1047506538 8:125485081-125485103 CCTTATCTCTAAAGTGGGGAGGG + Intergenic
1047745537 8:127842095-127842117 TCTTATTTTTAAAAGTTGTATGG + Intergenic
1048509914 8:135052989-135053011 TCTTACCTATAAATTGGGTGTGG + Intergenic
1048569937 8:135643810-135643832 CCTTATCTGTCAAATGGGTATGG + Intronic
1048781788 8:138009464-138009486 TTTAATCTGTAAAATGGGAATGG - Intergenic
1049161100 8:141098458-141098480 TCTCATCTGTAAAGTGGGTGGGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049699437 8:144002622-144002644 TTTCATCTTTAAAATGGGTGTGG - Intronic
1050410629 9:5361432-5361454 CCTTGTTTTTAAAATGAGTAAGG + Intronic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051157234 9:14162912-14162934 TCTTATCTTTTTAATGGATGTGG + Intronic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053357783 9:37461411-37461433 TCTTAAGTTTAAAATGTTTAGGG - Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1054993940 9:71363030-71363052 TCTCAACTTTAAAATTAGTAAGG - Intronic
1055349226 9:75368496-75368518 TCTCATCTTTAAAAAGGGAGAGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056431710 9:86534641-86534663 TTTTCTCTGTATAATGGGTAAGG + Intergenic
1056444587 9:86653537-86653559 TCCTATCTGTAAAATAGGTATGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057199350 9:93132109-93132131 TCTCATCTGTGAAATGGGTGTGG - Intronic
1057585746 9:96327234-96327256 TCTTTTCTTAAAAAAGGGTTGGG + Intronic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1058054701 9:100437466-100437488 TCTTATCTGGGAAATGGGAATGG + Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1059404620 9:114092233-114092255 TCTTATCTCTGAAATGGGGTGGG - Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1060052309 9:120386155-120386177 TCTCATTTGTAAAATGGGTGAGG + Intergenic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060168769 9:121443286-121443308 TCTTATCTTTACATTGTGCATGG - Intergenic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060571063 9:124641032-124641054 TATTATCTATAAAATGGGGGTGG - Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1061226950 9:129285974-129285996 CCTTGTCTATAAAATGGGGATGG - Intergenic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1062037020 9:134386890-134386912 CCTCATCTTTAAAATGGGAGTGG - Intronic
1062208319 9:135349276-135349298 TCTTTTCTTTAAAATGGGGCTGG - Intergenic
1062714071 9:137995568-137995590 TGTTATCTTTATAATTGTTATGG - Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186503981 X:10075243-10075265 TTTAATCTATAAAATGGGCAAGG + Intronic
1187248764 X:17577855-17577877 TCTCATCTTTAAAAAGGGATAGG + Intronic
1188295434 X:28441757-28441779 TCTCATCTTTAAAACGAGAATGG - Intergenic
1189907340 X:45775067-45775089 TTTGTTCTTTAAAATGGGTGGGG - Intergenic
1191733102 X:64358737-64358759 TATGATCTTTAGGATGGGTAAGG + Intronic
1192151723 X:68716955-68716977 TCCTATCTGTAAAATTGGAAGGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192833294 X:74773098-74773120 GCATATCTTTAAAATGGGGCAGG - Intronic
1193800039 X:85924143-85924165 TATTATTTTTAAAATGGGTCTGG + Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193847260 X:86488560-86488582 CATTATCTTTAAAATGAGTATGG + Intronic
1195208887 X:102631641-102631663 CCTTATTTTTAAAATGGCAAAGG + Intergenic
1195653740 X:107314185-107314207 TCTTTTTTTGAAAAGGGGTATGG + Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196829169 X:119762847-119762869 TCGCATCTATAAAATGGGCACGG - Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197368728 X:125600137-125600159 ACTTATATTTAAAATGGAAAAGG + Intergenic
1197459879 X:126727416-126727438 TCTCTTCCTTAAAATGGGAAGGG - Intergenic
1197721736 X:129749897-129749919 CCTTATCTGTAAAATGGGATGGG + Intronic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198653977 X:138893449-138893471 CCCTATCTTTAAAATGGGGGTGG - Intronic
1199540545 X:148953444-148953466 TCCTATCTATAAAATGGGAACGG + Intronic
1199855077 X:151753258-151753280 TGTTATCTATATAACGGGTAAGG + Intergenic
1201332166 Y:12836473-12836495 TCTTAGCTTTAAAGTAGGGATGG + Intronic
1201365162 Y:13197111-13197133 TTTTATCTTTTTAATGGTTAAGG - Intergenic