ID: 962789017

View in Genome Browser
Species Human (GRCh38)
Location 3:138793888-138793910
Sequence CCAGGCCACGTAGTGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962789013_962789017 18 Left 962789013 3:138793847-138793869 CCATCTCTTAAAAAAATTTCAGA 0: 1
1: 0
2: 23
3: 332
4: 3737
Right 962789017 3:138793888-138793910 CCAGGCCACGTAGTGTTCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962789017 Original CRISPR CCAGGCCACGTAGTGTTCTG TGG Intronic
909183089 1:72449846-72449868 CCATGCCACCTAGGGGTCTGGGG + Intergenic
913321321 1:117590641-117590663 CCAGGCCACGTTGTGGGCAGTGG - Intergenic
915064461 1:153213181-153213203 CCAGGCCACTTACTGAGCTGAGG + Intergenic
915095077 1:153456870-153456892 CCAGGCCAGGCAGTGTGCTATGG - Intergenic
920060868 1:203226079-203226101 CCTGCCCACTCAGTGTTCTGAGG - Intronic
923173640 1:231442056-231442078 CCAGGCCACATAGGATTTTGTGG + Intergenic
1067476582 10:46571376-46571398 CCAGGCCAATGAGTGCTCTGTGG - Intergenic
1067618156 10:47770405-47770427 CCAGGCCAATGAGTGCTCTGTGG + Intergenic
1067772837 10:49139566-49139588 CCAGGCCAGGTGGGGCTCTGGGG - Intergenic
1068302542 10:55163019-55163041 CCAGGCCAGGGACTATTCTGTGG + Intronic
1069468277 10:68661637-68661659 CCATGCCAGCTAGTTTTCTGGGG + Intronic
1076528330 10:131126783-131126805 CCAGGCCACGTCCTGTCCTTTGG + Intronic
1084627537 11:70319987-70320009 CCAGAGCACGTACTGCTCTGAGG + Intronic
1085530586 11:77189901-77189923 CCAGGCCAGGTTGCTTTCTGTGG - Intronic
1095953580 12:47794703-47794725 CCAGGCCCCAGAGTCTTCTGAGG + Intronic
1096363689 12:51010142-51010164 CCAGGCTAGTTAGTGTTCAGTGG - Intronic
1097056913 12:56255873-56255895 CCGGGCCACCAAGTGTGCTGAGG - Exonic
1101545839 12:105712015-105712037 AGAGGCCACTCAGTGTTCTGGGG + Intergenic
1103150765 12:118636671-118636693 CAAGGACACATTGTGTTCTGGGG + Intergenic
1106925586 13:34609607-34609629 ACAGGCCTCCTAGTCTTCTGTGG + Intergenic
1107130944 13:36894893-36894915 CATGGCCAAGTAGTGTTCTTGGG - Intronic
1117247097 14:53897225-53897247 CCAGGCCACCCAGTGTTCCCCGG + Intergenic
1118918594 14:70129257-70129279 CCAGGACACCAAGTTTTCTGTGG - Intronic
1119350303 14:73959163-73959185 CCAGGCTACGTTGTTTTCTGTGG - Exonic
1119526079 14:75323494-75323516 GCAGGCCATGTAGATTTCTGGGG - Intergenic
1119778714 14:77264391-77264413 CCAGGCCACCTAGAGAGCTGTGG + Intergenic
1121011710 14:90523810-90523832 ACAGGCCACGCGGTGTTTTGGGG + Intergenic
1121094364 14:91205600-91205622 CCAGGCGACCCAGTGGTCTGGGG + Intronic
1124871731 15:33550213-33550235 CAAGGCCAGGTAGTGGCCTGTGG - Exonic
1128495601 15:68196744-68196766 CCAGGCCTCGTCCTGCTCTGAGG + Intronic
1130253875 15:82316930-82316952 CCAGACCACGTGGTGGTGTGGGG - Intergenic
1136186198 16:28590325-28590347 TCTGGCCACGTAGTCTCCTGAGG - Exonic
1136318001 16:29465490-29465512 TCTGGCCACGTAGTCTCCTGAGG + Exonic
1136432576 16:30204839-30204861 TCTGGCCACGTAGTCTCCTGAGG + Exonic
1138197071 16:55059635-55059657 CCAGCACGTGTAGTGTTCTGAGG + Intergenic
1138456745 16:57125367-57125389 CCAGGCCCCTTGGTGGTCTGAGG + Intronic
1141381658 16:83582551-83582573 CCAGCCCACCCACTGTTCTGAGG + Intronic
1146656256 17:34636929-34636951 CCAGGCCTCATACTGCTCTGAGG - Intronic
1150143542 17:62750069-62750091 CCAGGCGGCGTGGTGTTCGGGGG - Intronic
1151395535 17:73820223-73820245 CCAGGCCGGGTTGTGTGCTGGGG - Intergenic
1152447891 17:80356406-80356428 CCTGGCTCCGTCGTGTTCTGTGG + Intronic
1152927034 17:83092121-83092143 CCAGGCCCCGCAGGGTTCAGGGG + Intronic
1159597512 18:70396384-70396406 CCAGGCCACGTTCATTTCTGGGG + Intergenic
1161954899 19:7488270-7488292 CCAGGCCATGGCGTGTTCTTTGG + Intronic
1162110143 19:8395655-8395677 CCAGGCCAAGCAGTGGTCTTTGG + Intronic
1163002231 19:14375631-14375653 CCAGGCCTCTTAGTCTCCTGGGG - Intergenic
1163641645 19:18465647-18465669 CCAGGCCAGGTGGTGGGCTGGGG - Intronic
1166052706 19:40269941-40269963 GCAGGCCGCGTAGGGTCCTGGGG - Intronic
925420079 2:3704200-3704222 CCAGGCCACGTGGTTTCCTGGGG + Intronic
931035813 2:58241469-58241491 CCAGGCCAAGTGGCGCTCTGCGG + Intergenic
941822587 2:169857361-169857383 CCCGGCCCCATTGTGTTCTGAGG + Intronic
942517444 2:176768741-176768763 CCAGGCCATGTACTTTTATGTGG - Intergenic
945946691 2:216001903-216001925 CCAGACCACGAAGGGCTCTGGGG + Intronic
1169172149 20:3473477-3473499 CCAGGCCAAGTGGAGATCTGTGG + Intronic
1172897078 20:38307713-38307735 GCAGGACTTGTAGTGTTCTGGGG + Intronic
1176039481 20:63056678-63056700 CCAGGCCCCCAAGTCTTCTGGGG + Intergenic
1176386448 21:6140527-6140549 CCAGGCCACCTGTGGTTCTGGGG + Intergenic
1179737025 21:43397725-43397747 CCAGGCCACCTGTGGTTCTGGGG - Intergenic
1181947736 22:26531312-26531334 GATGGCTACGTAGTGTTCTGTGG - Intronic
1183002349 22:34871889-34871911 CCAGGCCATGGTGTGGTCTGAGG - Intergenic
952406056 3:33006181-33006203 CCAGGCCACAGACTGGTCTGCGG + Intronic
959794725 3:110412185-110412207 CCAGGCTATGTAGTCTTGTGAGG + Intergenic
962352577 3:134666526-134666548 CCAGGGCACGAGGTGCTCTGAGG + Intronic
962789017 3:138793888-138793910 CCAGGCCACGTAGTGTTCTGTGG + Intronic
963110369 3:141683270-141683292 CCAGGACACCTAGTGTTGTCAGG + Intergenic
967232801 3:187356534-187356556 CCAGGCCATGAAGAGTTATGGGG + Intergenic
968599266 4:1501514-1501536 CCAGGCCAGGGAGAGCTCTGGGG - Intergenic
976934193 4:90608245-90608267 CCAGGCCACGGTGTTATCTGAGG + Intronic
982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG + Intergenic
986182027 5:5401901-5401923 CCAGGCCAGGCACTGCTCTGGGG - Intergenic
986309407 5:6541094-6541116 CCTGGCCACGTAGGGTTTTTGGG + Intergenic
991444652 5:66686069-66686091 ACAGGCCACGGACTGGTCTGTGG + Intronic
996350534 5:122536103-122536125 CCATTTCATGTAGTGTTCTGTGG + Intergenic
1004544055 6:16579780-16579802 CCAGGCCAGGCAATGTTCTCAGG + Intronic
1004797344 6:19102433-19102455 CTGGGCCACGTATTGTTCTGGGG + Intergenic
1011419280 6:87155201-87155223 CCAGTCCACGAAGTCTTCTACGG - Intronic
1011761663 6:90573882-90573904 CCTGGGCACTCAGTGTTCTGTGG + Intronic
1012947164 6:105479193-105479215 CCAGGCCTGGTGGTGTGCTGTGG - Intergenic
1027764149 7:82318387-82318409 GCAAGCCACATAGTGTGCTGGGG - Intronic
1028132285 7:87189739-87189761 GCAGGCCACATAGGTTTCTGAGG + Intronic
1032204875 7:129853869-129853891 CCAGGACATGTACTGTTCTGTGG - Intronic
1039336802 8:36600374-36600396 CCAGGCAAAGTTGTGTTATGTGG + Intergenic
1039896271 8:41718928-41718950 ACAGGCCACGTACTGTTATAGGG - Intronic
1043391758 8:79798713-79798735 CCAGGCCATGTGGTGGTCAGGGG - Intergenic
1047516014 8:125555465-125555487 GCAGGCCAGGCAGTGTGCTGGGG + Intergenic
1048448141 8:134508220-134508242 TCAGGCCAAGTAGTTCTCTGGGG - Intronic
1054948948 9:70826940-70826962 GCAAGCCACTTAGTGATCTGGGG + Intronic
1058384531 9:104418713-104418735 CTTGGCTAAGTAGTGTTCTGAGG - Intergenic
1060927482 9:127465147-127465169 TCAGGCCCCTTAGTGTCCTGGGG - Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1199212891 X:145234633-145234655 CCAGGCCAGGTACTGAACTGTGG - Intergenic
1200327776 X:155260575-155260597 CCAGGCCAGGCACTGTTTTGTGG - Exonic
1200607904 Y:5289425-5289447 CCAGCAAGCGTAGTGTTCTGTGG - Intronic