ID: 962793954

View in Genome Browser
Species Human (GRCh38)
Location 3:138834914-138834936
Sequence GCGCGCGCGCACACGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962793954 Original CRISPR GCGCGCGCGCACACGGGCGC GGG (reversed) Intronic
901417847 1:9129396-9129418 ACGCGGGGGCACACGGGCGGGGG - Intergenic
901506558 1:9689375-9689397 GCCCGAGCTCACACGGGCGGCGG - Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG + Intronic
903597019 1:24502809-24502831 GGGCGCGCGCACGGCGGCGCAGG - Intronic
904826941 1:33280174-33280196 GCGGGCGCGGGCACGGGCACGGG + Exonic
905137025 1:35808056-35808078 GCGTGCGCGGCCCCGGGCGCGGG - Intergenic
905231835 1:36519251-36519273 GCGCGCGCGCTCACGTGCAGGGG + Intergenic
905308557 1:37034673-37034695 TCGCGCGCTCACACCTGCGCGGG + Intergenic
905449118 1:38046040-38046062 GCGCACCTGCACCCGGGCGCGGG - Exonic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
912716837 1:111989385-111989407 GCGCCCACCCACCCGGGCGCGGG + Intergenic
913323522 1:117606620-117606642 GCGGGCGCGCACACCTTCGCCGG + Intronic
914490152 1:148146570-148146592 CCTCGGGCGCACCCGGGCGCTGG + Intronic
921390381 1:214608643-214608665 CCTCGGGCGCACCCGGGCGCTGG - Intronic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
923744273 1:236686352-236686374 GTGCGGGCGGACAAGGGCGCCGG - Intergenic
1065025061 10:21534011-21534033 GGGGGCGCGCACGCGGGGGCGGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1067560222 10:47300203-47300225 GGGCGCACGCACACGGCAGCCGG + Intergenic
1068620462 10:59176471-59176493 GCGTGCGCGCAGAAGGGCGGGGG + Intergenic
1069651463 10:70052938-70052960 GCGCGCCCCTCCACGGGCGCAGG - Exonic
1069695550 10:70382789-70382811 GCCCGCGCGCTCCCGGCCGCAGG + Intergenic
1069850686 10:71402751-71402773 GCGCGCGCGCACATGCGCGTTGG + Intronic
1072891770 10:99330366-99330388 GCGCCGGTGCACACGAGCGCCGG - Exonic
1074843309 10:117375555-117375577 GCGCCCGGGCACGCGGACGCGGG + Intergenic
1075871655 10:125775576-125775598 GCGCACGCGCGCACAGGCACAGG - Intronic
1076579534 10:131497448-131497470 GCGCGCGCGCACACACACACTGG + Intergenic
1083933379 11:65857923-65857945 GCGTGCGCGCCCGTGGGCGCCGG - Intronic
1084310330 11:68312864-68312886 GCGCCCGCGCACTTGGCCGCGGG - Intronic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1091021384 11:132103138-132103160 GCCTGGGCGCACACAGGCGCAGG + Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1093711724 12:22335306-22335328 GCGCGCACACACACGGGCCGCGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096116864 12:49060128-49060150 GCTCGCGCGGCCCCGGGCGCCGG - Intergenic
1096118471 12:49070134-49070156 GCGCGTGCGCAGACTGGAGCCGG + Intergenic
1096495458 12:52037164-52037186 GCGCGGGCGGCCGCGGGCGCGGG + Intronic
1096863777 12:54549401-54549423 GAGCGCACGCACACAGGCGCCGG - Exonic
1098161060 12:67648712-67648734 GCGCACTCACACACAGGCGCCGG - Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1100315696 12:93442229-93442251 ACGCGCGCGCAGTCGCGCGCGGG - Exonic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1102261238 12:111444791-111444813 GCGTGTGGGCACATGGGCGCAGG - Intronic
1103764675 12:123271708-123271730 GCGGGCGCTCGGACGGGCGCGGG - Exonic
1103800321 12:123533638-123533660 GCGGGCGCGGGCACGGGCGGCGG + Exonic
1104882937 12:132084685-132084707 GGGTGGGCGCTCACGGGCGCAGG - Intronic
1105240971 13:18609530-18609552 GCCCGCGCGGCCACAGGCGCGGG + Intergenic
1106422518 13:29595574-29595596 GCAGGCGCGCACGCGGCCGCGGG - Exonic
1107770933 13:43786985-43787007 GCGCGCGCGCCCACGGGGTGGGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113737637 13:112689906-112689928 CCGCGCTCGCACCCGCGCGCCGG - Intergenic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1119336048 14:73834477-73834499 GCACGCACCCACAGGGGCGCTGG + Intergenic
1121183575 14:91947700-91947722 GCGGGCGCGCGCAGGGGTGCGGG + Exonic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122666679 14:103334702-103334724 GCGGGCGCGGGCCCGGGCGCCGG + Intronic
1122993336 14:105249107-105249129 GCGTGGGCGCGCGCGGGCGCGGG - Intronic
1123490385 15:20775609-20775631 GCCCGCGCGGCCACAGGCGCGGG - Intergenic
1123546886 15:21344696-21344718 GCCCGCGCGGCCACAGGCGCGGG - Intergenic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125717687 15:41828331-41828353 GAGCGCGCGAACACGGGAGAAGG - Intronic
1126393924 15:48191624-48191646 GCGCGCGCGCACACGTACTTCGG + Exonic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1129644849 15:77420265-77420287 ACGCGCGCGCTCACGGGCCCCGG + Intergenic
1202955217 15_KI270727v1_random:71912-71934 GCCCGCGCGGCCACAGGCGCGGG - Intergenic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1136399823 16:30011182-30011204 TCGCGCGCGCACACTCACGCAGG + Intronic
1136627799 16:31472457-31472479 GCCCGCGGGCGCCCGGGCGCGGG + Intronic
1137988920 16:53131902-53131924 GCGGCCGCACACACGGGGGCTGG - Intronic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1139754656 16:69132624-69132646 GCGCGCGCGCACGTGGGGCCGGG + Exonic
1142156292 16:88534159-88534181 GCGCGTGCGCACAGGCGCGGCGG - Exonic
1142229303 16:88892252-88892274 GCGCGTGCGCACACTGGTGCTGG - Exonic
1142954746 17:3513885-3513907 GCGCACGCGCACACCAGCTCTGG + Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143321150 17:6070228-6070250 GCCCGCGAGAACACGCGCGCGGG - Intronic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147636485 17:41967264-41967286 TCCCGCCCGCACCCGGGCGCGGG - Intronic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147970838 17:44218693-44218715 GCGCGCGCGGCCACGGAAGCGGG + Intronic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148781521 17:50124748-50124770 GCGCGCGCGTGCACGCGTGCAGG - Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1149490984 17:57085180-57085202 GCGCGCGGGCACAAGGGCGAGGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154447995 18:14450378-14450400 GCCCGCGCGGCCACGGGCGCGGG - Intergenic
1156501996 18:37566082-37566104 GCGCGCGCGGAGGAGGGCGCGGG + Intergenic
1159040449 18:63319518-63319540 ACACGCGCGCACACACGCGCGGG + Exonic
1160263898 18:77321981-77322003 GTGCACGCGCACACGTGTGCTGG + Intergenic
1160499790 18:79395996-79396018 GGGCGCGGGCACCGGGGCGCGGG + Intronic
1160767012 19:813210-813232 GAGGGCGCGCAGACGGGGGCCGG - Exonic
1160995752 19:1881369-1881391 CCTCGGGCGCACCCGGGCGCTGG - Exonic
1161309388 19:3585639-3585661 GCGGGGGCGCAGACGCGCGCGGG - Exonic
1161461577 19:4400610-4400632 GCGCGTGCGCAGACGGGGCCGGG - Intergenic
1161802581 19:6424396-6424418 GCGCGCGCGCAGGCGGGGGAGGG - Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1163019002 19:14472860-14472882 GCGCGGGCGCAGGGGGGCGCAGG + Intronic
1163369809 19:16895872-16895894 GCGCGCGCGCATACGGGTCAAGG - Intronic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1163829318 19:19540296-19540318 GGTCGCGGGCACACGCGCGCTGG - Exonic
1165349399 19:35268138-35268160 GCGCGCACGCAGGCGGGCGGCGG - Intergenic
1166330683 19:42076430-42076452 GCGCGCGGGCAGCCGGGCGGGGG + Intronic
1167019133 19:46861214-46861236 GTGCGCGAGCTCACGGGCCCCGG + Intergenic
1167129153 19:47573082-47573104 GCGCGCGAGCCCCCGGGGGCGGG - Intergenic
1167649273 19:50720479-50720501 GCGCGCGCACACACGCACACAGG + Intergenic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
927702530 2:25277151-25277173 GCGCGCCCGCCCACGCGCACAGG - Intronic
928904664 2:36356376-36356398 GCGCTCCGGCACCCGGGCGCTGG + Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
936713612 2:115161428-115161450 ACCCGCGCGCCCACGGCCGCCGG - Intronic
937950916 2:127387590-127387612 GCGCGCGAGGAGTCGGGCGCGGG + Intronic
938339792 2:130527793-130527815 GCGCGGGCGCATCCGGGCGCAGG - Exonic
938350044 2:130592957-130592979 GCGCGGGCGCATCCGGGCGCAGG + Exonic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
942098657 2:172556611-172556633 GCGCACCTGCACACGTGCGCCGG - Intronic
949018175 2:241725283-241725305 GCGCGCCCGCCCACGTCCGCCGG - Exonic
1172841291 20:37903945-37903967 GCGCGCGCGCACACACACACAGG + Intronic
1173582934 20:44160131-44160153 GCGCGGGCGCCCAAGGGCGGCGG - Exonic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1175511056 20:59526386-59526408 GCGAGAGCGCACAGGTGCGCAGG + Intergenic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1175992412 20:62796443-62796465 GCGCAGGCGCACTCGGGGGCGGG - Exonic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1178673775 21:34614498-34614520 GCCTGGGCGCACACGGGGGCCGG + Intronic
1180949459 22:19714644-19714666 GCGCGCGCGGGCACGCGGGCAGG - Intronic
1181334491 22:22117811-22117833 CCTCGGGCGCACCCGGGCGCTGG - Intergenic
1182222980 22:28773102-28773124 GCGGGCGCGGGCAGGGGCGCGGG + Intronic
1182904055 22:33921081-33921103 GCGGGCGCCGACGCGGGCGCCGG - Intronic
1183149784 22:36028529-36028551 GCACGCACGCACGCGGGGGCGGG - Intergenic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185285922 22:49999822-49999844 GCTCACTCGCACAGGGGCGCCGG + Exonic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
950418613 3:12883226-12883248 GAGTGCGGGCACACAGGCGCCGG + Intergenic
950683974 3:14603194-14603216 GCGCGCGCTTTCCCGGGCGCCGG + Intergenic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954694010 3:52410637-52410659 GCGAGCGCGCAAACGGGGGTGGG - Exonic
955060058 3:55486345-55486367 GCCAGCGCGCACCCCGGCGCGGG - Intronic
961386137 3:126524419-126524441 GCGGGCACTCACCCGGGCGCAGG - Exonic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
963228758 3:142889010-142889032 GCGCGCGGGCAGCCGAGCGCCGG - Exonic
963607237 3:147421612-147421634 ACGCGCGCGCACGCTGTCGCGGG - Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964862890 3:161221520-161221542 GCGCGACCGCACACGGGTTCCGG - Intronic
969597869 4:8159019-8159041 GCGCAGGCGCAGACGGGCGACGG + Intergenic
970593186 4:17577177-17577199 GCGCCCGCGCATGCGGGCGGGGG - Exonic
970593193 4:17577190-17577212 GCGCGGGCGCACACGAATGCGGG + Exonic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
978366592 4:107989668-107989690 GCCCGCGCTCACTCGGGCTCCGG + Intergenic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
986321096 5:6633298-6633320 GCGCGTGCGCAGAGCGGCGCGGG + Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
991913910 5:71587449-71587471 AGGCGCGGGCACACGGCCGCAGG - Exonic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998199483 5:140108092-140108114 GCGCGCGCGCACACCTGTCCTGG - Intronic
1002488762 5:179559104-179559126 GCGCGCGCGCGCCCGGGTGAGGG + Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1004272940 6:14211325-14211347 GCTCGCGCGGACCCGGGCGACGG - Intergenic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1005303746 6:24494936-24494958 GCGCGCGCGCACGGGAACGCAGG - Intronic
1005864263 6:29926578-29926600 GGGCCCGCGCACTGGGGCGCAGG + Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1007589726 6:43013870-43013892 GCGCGCGGGAACACCGGCGCCGG - Exonic
1011640473 6:89412336-89412358 GCGCGCGCTCGCCCGGCCGCGGG + Intergenic
1012245855 6:96924779-96924801 TCGCGCGCACACACGCACGCAGG + Exonic
1014913196 6:127118148-127118170 GCGCTGGGGCACAAGGGCGCAGG + Intergenic
1018730825 6:166649214-166649236 GCAGGAGCGCAGACGGGCGCAGG - Intronic
1019611535 7:1939264-1939286 GCGCGCGCACACATGGGCCAGGG + Intronic
1021600206 7:22356932-22356954 GCGCTCGGGCTCCCGGGCGCTGG + Intronic
1023983612 7:45082992-45083014 GCGCGAGCGCACACAGGTGATGG - Exonic
1026727205 7:72879307-72879329 GCACGCGCGAACACGCACGCAGG - Intergenic
1026923648 7:74174222-74174244 GCGCACGCACGCACGGACGCTGG - Intergenic
1027275178 7:76549283-76549305 GCACGCGCGAACACGCACGCAGG - Intergenic
1029238834 7:99144158-99144180 GCGCGCACGCACGCAGGCGCGGG - Intergenic
1029720886 7:102363833-102363855 GCACGCGCGAACACGCACGCAGG - Intergenic
1032379807 7:131466929-131466951 GCGCGCGCACACACGCACGCAGG + Intronic
1033365947 7:140672907-140672929 GCGCGGGCGCAGGCGGGGGCCGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1035599945 8:891489-891511 GCCCACGCACACACGGGTGCAGG - Intergenic
1037116852 8:15237435-15237457 GGGGACGCGCACCCGGGCGCAGG - Intronic
1037450695 8:19013715-19013737 GCCCGCGCGCACCCTGGCGGAGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038176349 8:25184732-25184754 GCGGGCACGGGCACGGGCGCGGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1043502973 8:80874375-80874397 GCGCGCGCGGGCTCGGCCGCCGG - Intronic
1045918297 8:107499829-107499851 GTGCGCGCGCACGCGTGTGCTGG - Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1049013019 8:139900189-139900211 GCACACACGCACACGGGCTCAGG - Intronic
1051774492 9:20620479-20620501 GCGCGCGGGCAGGCGGGAGCCGG + Intronic
1052807532 9:33025727-33025749 GCGCACGCGCACAGGGAGGCAGG + Intronic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1057259892 9:93577327-93577349 GCGGGCGCGCAGCCCGGCGCGGG + Intronic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1060215955 9:121738268-121738290 GCGCGAGGGCACAGGGGCACCGG - Intronic
1060661718 9:125408555-125408577 CCGCGCACGCACACGGCCGACGG - Intergenic
1061084758 9:128392499-128392521 GCCCGCGCGCACAGAGACGCCGG - Intergenic
1062084584 9:134642120-134642142 GCGGGGACGCACAGGGGCGCGGG - Exonic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1189310506 X:40014432-40014454 GCGCGCGCGCGCTCGAGTGCCGG + Intergenic
1189473635 X:41333221-41333243 GCGCGCGCGCACACGTCGGGGGG + Intergenic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1200128999 X:153830913-153830935 GCGAGCGCGCCCACGGCGGCGGG + Intergenic