ID: 962795304

View in Genome Browser
Species Human (GRCh38)
Location 3:138844808-138844830
Sequence TTGAAAAAGGAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962795299_962795304 23 Left 962795299 3:138844762-138844784 CCATCTCAAAAAAAAAGGGCTGT No data
Right 962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962795304 Original CRISPR TTGAAAAAGGAGAGGGAGGC TGG Intergenic
No off target data available for this crispr