ID: 962801621 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:138895617-138895639 |
| Sequence | TAATCCTAGAGAGGCCGAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 962801621_962801625 | 0 | Left | 962801621 | 3:138895617-138895639 | CCCATTCGGCCTCTCTAGGATTA | No data | ||
| Right | 962801625 | 3:138895640-138895662 | CAGGCATGAGCCACCATGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 962801621 | Original CRISPR | TAATCCTAGAGAGGCCGAAT GGG (reversed) | Intergenic | ||