ID: 962801621

View in Genome Browser
Species Human (GRCh38)
Location 3:138895617-138895639
Sequence TAATCCTAGAGAGGCCGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962801621_962801625 0 Left 962801621 3:138895617-138895639 CCCATTCGGCCTCTCTAGGATTA No data
Right 962801625 3:138895640-138895662 CAGGCATGAGCCACCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962801621 Original CRISPR TAATCCTAGAGAGGCCGAAT GGG (reversed) Intergenic