ID: 962804875

View in Genome Browser
Species Human (GRCh38)
Location 3:138919824-138919846
Sequence AGGTGGGACAATGCAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962804875_962804883 24 Left 962804875 3:138919824-138919846 CCATGCTTTGCATTGTCCCACCT No data
Right 962804883 3:138919871-138919893 GCTGCACATTAGAAGCACCTGGG No data
962804875_962804882 23 Left 962804875 3:138919824-138919846 CCATGCTTTGCATTGTCCCACCT No data
Right 962804882 3:138919870-138919892 TGCTGCACATTAGAAGCACCTGG No data
962804875_962804876 -10 Left 962804875 3:138919824-138919846 CCATGCTTTGCATTGTCCCACCT No data
Right 962804876 3:138919837-138919859 TGTCCCACCTTCTATAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962804875 Original CRISPR AGGTGGGACAATGCAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr