ID: 962808864

View in Genome Browser
Species Human (GRCh38)
Location 3:138945676-138945698
Sequence GCCTGCAGTTCGCTTGTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962808864_962808876 8 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808876 3:138945707-138945729 CTGGTGGGCGCGGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 47
4: 461
962808864_962808867 -8 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808867 3:138945691-138945713 CTGCAGGCCCGGCGCACTGGTGG 0: 1
1: 0
2: 2
3: 22
4: 252
962808864_962808868 -7 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808868 3:138945692-138945714 TGCAGGCCCGGCGCACTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 103
962808864_962808882 24 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808882 3:138945723-138945745 CCGGGGGCGCGGCGGTGGCTGGG 0: 1
1: 0
2: 3
3: 39
4: 480
962808864_962808878 16 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808878 3:138945715-138945737 CGCGGGCGCCGGGGGCGCGGCGG 0: 1
1: 3
2: 26
3: 239
4: 1141
962808864_962808874 6 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808874 3:138945705-138945727 CACTGGTGGGCGCGGGCGCCGGG 0: 1
1: 0
2: 2
3: 10
4: 165
962808864_962808883 28 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808883 3:138945727-138945749 GGGCGCGGCGGTGGCTGGGCTGG 0: 1
1: 1
2: 11
3: 124
4: 1019
962808864_962808879 19 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808879 3:138945718-138945740 GGGCGCCGGGGGCGCGGCGGTGG 0: 1
1: 1
2: 37
3: 273
4: 1786
962808864_962808873 5 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808873 3:138945704-138945726 GCACTGGTGGGCGCGGGCGCCGG 0: 1
1: 0
2: 5
3: 28
4: 245
962808864_962808880 23 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808880 3:138945722-138945744 GCCGGGGGCGCGGCGGTGGCTGG 0: 1
1: 1
2: 9
3: 162
4: 1183
962808864_962808875 7 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808875 3:138945706-138945728 ACTGGTGGGCGCGGGCGCCGGGG 0: 1
1: 0
2: 3
3: 31
4: 249
962808864_962808877 13 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808877 3:138945712-138945734 GGGCGCGGGCGCCGGGGGCGCGG 0: 1
1: 2
2: 58
3: 341
4: 2043
962808864_962808869 -2 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808869 3:138945697-138945719 GCCCGGCGCACTGGTGGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 159
962808864_962808871 -1 Left 962808864 3:138945676-138945698 CCGGGCACAAGCGAACTGCAGGC 0: 1
1: 0
2: 1
3: 8
4: 143
Right 962808871 3:138945698-138945720 CCCGGCGCACTGGTGGGCGCGGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962808864 Original CRISPR GCCTGCAGTTCGCTTGTGCC CGG (reversed) Exonic
900623905 1:3599521-3599543 GCCTGCAGTGTGCCTGTGCCAGG - Intronic
900675134 1:3880720-3880742 GCCCGGAGCTCGCTTGGGCCTGG + Intronic
900675139 1:3880737-3880759 GCCTGGAGCTCGCTTGGGCCTGG + Intronic
900783591 1:4633640-4633662 GCCTGCACTTCGCTTGTCAGAGG + Intergenic
901073833 1:6539710-6539732 GCCGGCAGATTGCTTGAGCCTGG - Intronic
901734549 1:11304211-11304233 GGCTGCAGTTGGCTGGTGGCTGG + Intergenic
901735287 1:11308498-11308520 GGCTGCAGTTGGCTGGTGGCTGG - Intergenic
904223616 1:28994886-28994908 GCAGGCAGATCGCTTGAGCCGGG - Intronic
905001999 1:34679888-34679910 CCCTGCAGTAGGCTTCTGCCTGG + Intergenic
905225612 1:36477055-36477077 TCCTCCAGTTCGTTAGTGCCTGG - Intronic
906245679 1:44272081-44272103 CCCTGCCCTTCGCTTGTCCCTGG - Intronic
907160612 1:52366214-52366236 GCCGGCAGTGCGCATGTGCACGG + Intergenic
907895610 1:58687335-58687357 GCCTTCAGTTCGCTTCGCCCGGG - Intronic
908558529 1:65282132-65282154 CCCTGGAGTTCACTTGAGCCTGG - Intronic
908707475 1:66975296-66975318 GCATGCAGATTGCTTGAGCCTGG + Intronic
911527358 1:99004049-99004071 GCCTCCTCTTCGATTGTGCCTGG - Intronic
915482509 1:156196616-156196638 GCATGCATTTTGCATGTGCCTGG + Intronic
918866073 1:189902237-189902259 GCAGGCAGATCGCTTGAGCCTGG - Intergenic
919526758 1:198663126-198663148 GCCTGCAGTGCAATTGTGCAGGG - Intronic
920149543 1:203893437-203893459 GCATGCAGATCACTTGAGCCTGG + Intergenic
922701437 1:227763493-227763515 CTCTGCAGTTCGTTAGTGCCAGG + Intronic
922766848 1:228160445-228160467 GCTTGCAGTTGGCATCTGCCCGG - Intergenic
1063664760 10:8054571-8054593 GGTTGCAGTTTCCTTGTGCCGGG + Intronic
1065740712 10:28794555-28794577 GCCAGAAGATCGCTTGAGCCTGG + Intergenic
1070048979 10:72868318-72868340 GCAGGCAGATCGCTTGAGCCCGG + Intronic
1071338380 10:84620808-84620830 CCCTGCAGTGAGCTTCTGCCCGG - Intergenic
1072069547 10:91903349-91903371 GCGGGCAGATCGCTTGAGCCCGG - Intergenic
1074836815 10:117303886-117303908 GCCTGCAGTAAACTTTTGCCTGG - Intronic
1078191180 11:9093348-9093370 TCCTGCAGCGCCCTTGTGCCTGG + Intronic
1078314053 11:10277189-10277211 GCGGGCAGATCGCTTGAGCCCGG + Intronic
1078994754 11:16685815-16685837 CCCTGCAGTAGGCTTCTGCCTGG + Intronic
1081590282 11:44417978-44418000 GCCTGTACTTAGCCTGTGCCTGG - Intergenic
1083330022 11:61893121-61893143 GCCTGCAGCCCCCTTGGGCCAGG - Intergenic
1084396176 11:68911942-68911964 GCCTGGAGTTGGCCTGGGCCCGG + Intronic
1091335234 11:134761579-134761601 GCTTGCAGCTGGCTTGTTCCCGG - Intergenic
1091578544 12:1763748-1763770 GCGGGCAGATCGCTTGAGCCCGG + Intronic
1091882814 12:3993171-3993193 GCCTGCATTCCACTAGTGCCTGG - Intergenic
1102007918 12:109600264-109600286 CCCTGCCCTTCGCTTGTGCTTGG + Intergenic
1107039435 13:35933461-35933483 TCCTGCAGTAAACTTGTGCCTGG + Intronic
1107968196 13:45615927-45615949 GCCTGAAGGTCGCCTGTGTCAGG + Intergenic
1110962134 13:81639983-81640005 GACTGCAGTTTGCTTGTTCAAGG + Intergenic
1112210552 13:97373115-97373137 TCTCGCAGTTTGCTTGTGCCTGG + Intronic
1113054094 13:106249110-106249132 GGCTGGAGTCCGCTTTTGCCAGG - Intergenic
1116780874 14:49236391-49236413 CCCTGCAGTACACTTCTGCCTGG - Intergenic
1117709394 14:58509124-58509146 GGCAGCAGATTGCTTGTGCCCGG + Intronic
1121704708 14:95982865-95982887 GCCTGCTGATGGCTTGTGTCTGG + Intergenic
1122072523 14:99213843-99213865 CCCAGCAGTACCCTTGTGCCTGG - Intronic
1122264816 14:100541630-100541652 GCCTGCAGCCCTCTGGTGCCAGG - Intronic
1122908849 14:104816441-104816463 CCCTGCAGTTCCCCTCTGCCCGG - Intergenic
1127793991 15:62423015-62423037 GCCTGCAGCTGGCTTCTCCCAGG + Intronic
1129591984 15:76924154-76924176 GGCTGGAGTTCAGTTGTGCCAGG + Intergenic
1134654831 16:15940217-15940239 GCAGGCAGATCGCTTGAGCCAGG + Intergenic
1136075825 16:27816742-27816764 CCCTGCAGCTGGCTTGTGGCAGG + Intronic
1136519889 16:30788425-30788447 GCAGGCAGATCGCTTGAGCCCGG + Intergenic
1137659959 16:50196697-50196719 GCGGGCAGATCGCTTGAGCCAGG + Intronic
1143598094 17:7927709-7927731 CCCTGCAGTTCTCATGTGCCTGG - Intronic
1144944949 17:18965128-18965150 TCCTGCATTTGGCTTGTGCAAGG - Intronic
1151352942 17:73542461-73542483 GGCTGGAGTTCGCTTGTGGCAGG - Intronic
1153269000 18:3300470-3300492 GCAGGCAGATCGCTTGAGCCCGG + Intergenic
1156169355 18:34463399-34463421 CCCTGCAGTTAACTTCTGCCTGG + Intergenic
1158253611 18:55519202-55519224 GCATGCAGATCACTTGAGCCTGG + Intronic
1158511452 18:58094413-58094435 GCGGGCAGATCGCTTGAGCCCGG - Intronic
1158529170 18:58242732-58242754 GCAGGCAGATCGCTTGAGCCCGG - Intronic
1164616408 19:29669218-29669240 GCCTGCAGCTCTCTTCTGCCTGG + Intronic
925064845 2:921908-921930 GCCTGCTGTTGGCTTGTCCACGG + Intergenic
931276483 2:60748018-60748040 GCCTGCACTTAGCTTCTCCCAGG - Intergenic
931307179 2:61041080-61041102 GCCTGCAGATCGCTTAAGCCTGG + Intronic
931317609 2:61147291-61147313 GCCCGCAGATCGCTTGAGCCTGG - Intronic
935315491 2:101829632-101829654 GAGTGCAGCTGGCTTGTGCCAGG - Intronic
935798741 2:106671286-106671308 ACCTGCAGCAGGCTTGTGCCTGG - Intergenic
942605707 2:177688254-177688276 AGCTGCAGATTGCTTGTGCCAGG + Intronic
943557834 2:189427386-189427408 CCCTGCAGCTGGCTTCTGCCTGG - Intergenic
947469095 2:230383645-230383667 GCCTGCAGTTCACGAGGGCCAGG + Intronic
947898123 2:233694248-233694270 GGCTGTAGTTCGCTGGTCCCTGG - Intronic
949010548 2:241675992-241676014 GCCTGCAGATCTCTGCTGCCGGG + Exonic
1172270175 20:33650593-33650615 GCAGGCAGATCGCTTGAGCCCGG - Intergenic
1173322618 20:42001778-42001800 GGCTGCAGTTTGCCAGTGCCAGG - Intergenic
1176707491 21:10126691-10126713 GCCTGAAGTTCGTCTATGCCTGG + Intergenic
1181161653 22:20963393-20963415 GCCTGCACTTGCCTTGTGTCAGG + Intergenic
1181561727 22:23707295-23707317 GCCTGCAGTTTCCATGTTCCGGG - Intergenic
1182753154 22:32657783-32657805 GTCTGCACTTTGGTTGTGCCTGG - Intronic
1183311812 22:37113912-37113934 GCCTGCTGTTCGCAGGAGCCCGG - Intergenic
950417726 3:12877887-12877909 GCCTGCAGGCCGCCTGTGACTGG + Intergenic
952740351 3:36728561-36728583 GCCTGCAGTTCTGATGTCCCAGG - Intronic
954290008 3:49644666-49644688 ACCAGCAGTGAGCTTGTGCCTGG - Intronic
954421206 3:50419975-50419997 GCCAGCAGTTCCCTGGGGCCAGG + Intronic
956130552 3:66049449-66049471 GCAGGCAGATCGCTTGAGCCCGG + Intergenic
957865435 3:86017500-86017522 ACCCGCAGATCGCTTGAGCCAGG + Intronic
962808864 3:138945676-138945698 GCCTGCAGTTCGCTTGTGCCCGG - Exonic
972964363 4:44491215-44491237 GCAAGCAGATCGCTTGAGCCTGG + Intergenic
976664913 4:87580194-87580216 GCCTGAAGTTCCCCTGTCCCTGG + Intergenic
977535348 4:98250760-98250782 GCCTGCAGTTCCGCTCTGCCTGG + Intergenic
986682223 5:10244463-10244485 GCCAGAAGATCGCTTGAGCCCGG + Intronic
990954612 5:61330798-61330820 GAGTGCAGCTCGCTGGTGCCTGG - Intergenic
991732904 5:69606225-69606247 GCCGGCAGATCACTTGAGCCCGG + Intergenic
991809340 5:70461369-70461391 GCCGGCAGATCACTTGAGCCCGG + Intergenic
991862049 5:71021627-71021649 GCCGGCAGATCACTTGAGCCCGG - Intronic
992101974 5:73416882-73416904 ACCTGCAGTTCTCTTTTTCCAGG - Intergenic
992482801 5:77168288-77168310 GCCTGCTCTTCACTTGTGTCAGG + Intergenic
993699407 5:91100191-91100213 GCATGCGGATCGCTTGAGCCCGG + Intronic
1000979139 5:167798169-167798191 GCCTGCAGTTAGCTTGCGCCTGG - Intronic
1002474207 5:179454655-179454677 GGCTGCAGTTCCCCTGGGCCGGG + Intergenic
1002801124 6:522357-522379 TCCTGCAGTCCGCATGGGCCTGG - Intronic
1003681058 6:8257595-8257617 GCAGGCAGGTCGCTTGAGCCCGG + Intergenic
1004845278 6:19634918-19634940 ACCTGCAGTTCCCTTGAGGCTGG + Intergenic
1005695596 6:28350039-28350061 TCCTGCAGTTCTTTTGTCCCCGG + Exonic
1005908177 6:30283932-30283954 CCCTGCAGCTGGCTTCTGCCTGG + Intergenic
1008687674 6:53943344-53943366 CCCTGCAGTTCTCTTGACCCAGG - Intronic
1009383625 6:63063198-63063220 CCCTGCAGTAAGCTTTTGCCTGG - Intergenic
1014143604 6:117971571-117971593 CCCTGCAGTAAGCTTCTGCCTGG + Intronic
1015216051 6:130750838-130750860 GCAGGCAGATCGCTTGAGCCTGG - Intergenic
1017944203 6:159080382-159080404 GCCTGGAGTTCACTTCTGACTGG - Intergenic
1018400665 6:163415726-163415748 GCCTGGAGGACGCGTGTGCCCGG + Intronic
1018490087 6:164283541-164283563 GCCTGCAGGTCACGTGTGCTTGG - Intergenic
1018984745 6:168627930-168627952 GCCTGCAGTGCCTTTGTGCAAGG - Intronic
1019276520 7:178706-178728 GCCTGCTGTGGGCCTGTGCCCGG - Intergenic
1021063179 7:16139676-16139698 GCCTTCAGATCCCTTTTGCCTGG + Intronic
1026068292 7:67095287-67095309 GCATGCAGTTCGGTTGGGCACGG - Intronic
1027484102 7:78738538-78738560 GCCTGCAGTTTTATTGTGGCAGG - Intronic
1028473991 7:91234141-91234163 ACTGGCAGTTCGCTTTTGCCAGG + Intergenic
1029741418 7:102493690-102493712 GCCTGCTGTTGGCATTTGCCAGG - Intronic
1029759410 7:102592859-102592881 GCCTGCTGTTGGCATTTGCCAGG - Intronic
1029776777 7:102688769-102688791 GCCTGCTGTTGGCATTTGCCAGG - Intergenic
1030930883 7:115522100-115522122 CCCTGCAGTAGGCTTGTTCCTGG + Intergenic
1032861985 7:135889054-135889076 GCCTCCAGTCCGCTTATTCCAGG + Intergenic
1034789338 7:153953902-153953924 GCCTGCATTTCCCTCCTGCCAGG - Intronic
1035128615 7:156630062-156630084 TCCTGCAGTAGGCTTCTGCCTGG - Intergenic
1037009146 8:13819229-13819251 GCCTGCAGTGTGTTTCTGCCTGG + Intergenic
1037771834 8:21805850-21805872 GCCAGCAGTTCCCATCTGCCTGG + Intronic
1044875577 8:96662757-96662779 GCAGGCAGATCGCTTGAGCCCGG + Intronic
1046105537 8:109661501-109661523 GAGTGCAGTTTGCATGTGCCTGG + Intronic
1048087700 8:131201812-131201834 CCCTGCAGTAGGCTTCTGCCTGG - Intergenic
1049495174 8:142926820-142926842 TCCTGCAGTTCTCTTGAACCTGG + Intergenic
1049605152 8:143525924-143525946 GCCTGCCGTCCGCCTGGGCCTGG + Intronic
1051546686 9:18283510-18283532 GCAGGAAGTTCGCTTGAGCCTGG + Intergenic
1051824124 9:21199554-21199576 GGCTGCAGTTGGGTCGTGCCTGG - Intergenic
1052545447 9:29871803-29871825 GCCAGCAGATCACTTGAGCCTGG - Intergenic
1054811828 9:69441239-69441261 GCCTGCAGGCCTCTGGTGCCTGG + Intronic
1057991000 9:99769509-99769531 GCAGGCAGATCGCTTGAGCCCGG + Intergenic
1058465386 9:105221925-105221947 GCCTGCAGTAGGGTTGTGCCTGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059917312 9:119118005-119118027 CCCTGCAGTAGGCTTCTGCCTGG - Intergenic
1061019751 9:128006574-128006596 GCATGAGGTTCGCTTGAGCCTGG - Intergenic
1202792239 9_KI270719v1_random:95571-95593 GCCTGAAGTTCGTCTATGCCTGG + Intergenic
1187649969 X:21391325-21391347 CCCTGCAGTAGACTTGTGCCTGG + Intronic
1188168107 X:26887440-26887462 GCCTGCAGTTCACCTGTACTTGG + Intergenic
1189253731 X:39621223-39621245 CCCTGCAGTAAGCTTCTGCCTGG + Intergenic
1190954184 X:55175477-55175499 GCCGGCAGATCCCTTGAGCCTGG + Intronic
1193996120 X:88367289-88367311 CCCTGCAGTAGGCTTTTGCCTGG + Intergenic
1194922247 X:99780525-99780547 GCCTGCAGCAGGCTTCTGCCTGG + Intergenic
1198438151 X:136636800-136636822 GCCTGCCCTTCCCTTGTCCCTGG + Intergenic
1199012660 X:142776225-142776247 GCCTGCTGTTTGATTGTGTCTGG - Intergenic
1199551195 X:149063475-149063497 GGCTGCAGTACGCTTGTGATGGG + Intergenic