ID: 962809210

View in Genome Browser
Species Human (GRCh38)
Location 3:138947048-138947070
Sequence GCTTCGGGAAACCGGGGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962809210_962809219 -6 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809210_962809220 -3 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809220 3:138947068-138947090 AGCACGACCCGCGTCTCTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 61
962809210_962809226 28 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809210_962809223 10 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962809210 Original CRISPR GCTTCGGGAAACCGGGGGGC GGG (reversed) Exonic