ID: 962809219

View in Genome Browser
Species Human (GRCh38)
Location 3:138947065-138947087
Sequence CGAAGCACGACCCGCGTCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962809212_962809219 -10 Left 962809212 3:138947052-138947074 CCCCCCGGTTTCCCGAAGCACGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809209_962809219 -5 Left 962809209 3:138947047-138947069 CCCCGCCCCCCGGTTTCCCGAAG 0: 1
1: 0
2: 0
3: 15
4: 375
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809207_962809219 -3 Left 962809207 3:138947045-138947067 CCCCCCGCCCCCCGGTTTCCCGA 0: 1
1: 0
2: 1
3: 15
4: 238
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809206_962809219 0 Left 962809206 3:138947042-138947064 CCTCCCCCCGCCCCCCGGTTTCC 0: 1
1: 0
2: 19
3: 140
4: 1281
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809210_962809219 -6 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809211_962809219 -7 Left 962809211 3:138947049-138947071 CCGCCCCCCGGTTTCCCGAAGCA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809208_962809219 -4 Left 962809208 3:138947046-138947068 CCCCCGCCCCCCGGTTTCCCGAA 0: 1
1: 0
2: 0
3: 23
4: 541
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809205_962809219 1 Left 962809205 3:138947041-138947063 CCCTCCCCCCGCCCCCCGGTTTC 0: 1
1: 0
2: 5
3: 90
4: 708
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
962809204_962809219 2 Left 962809204 3:138947040-138947062 CCCCTCCCCCCGCCCCCCGGTTT 0: 1
1: 0
2: 5
3: 126
4: 1004
Right 962809219 3:138947065-138947087 CGAAGCACGACCCGCGTCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962809219 Original CRISPR CGAAGCACGACCCGCGTCTC TGG Exonic