ID: 962809223

View in Genome Browser
Species Human (GRCh38)
Location 3:138947081-138947103
Sequence TCTCTGGCGGAGCTGCCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 213}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962809214_962809223 4 Left 962809214 3:138947054-138947076 CCCCGGTTTCCCGAAGCACGACC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809213_962809223 5 Left 962809213 3:138947053-138947075 CCCCCGGTTTCCCGAAGCACGAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809209_962809223 11 Left 962809209 3:138947047-138947069 CCCCGCCCCCCGGTTTCCCGAAG 0: 1
1: 0
2: 0
3: 15
4: 375
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809206_962809223 16 Left 962809206 3:138947042-138947064 CCTCCCCCCGCCCCCCGGTTTCC 0: 1
1: 0
2: 19
3: 140
4: 1281
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809216_962809223 2 Left 962809216 3:138947056-138947078 CCGGTTTCCCGAAGCACGACCCG 0: 1
1: 0
2: 0
3: 2
4: 21
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809204_962809223 18 Left 962809204 3:138947040-138947062 CCCCTCCCCCCGCCCCCCGGTTT 0: 1
1: 0
2: 5
3: 126
4: 1004
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809210_962809223 10 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809205_962809223 17 Left 962809205 3:138947041-138947063 CCCTCCCCCCGCCCCCCGGTTTC 0: 1
1: 0
2: 5
3: 90
4: 708
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809212_962809223 6 Left 962809212 3:138947052-138947074 CCCCCCGGTTTCCCGAAGCACGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809211_962809223 9 Left 962809211 3:138947049-138947071 CCGCCCCCCGGTTTCCCGAAGCA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809217_962809223 -5 Left 962809217 3:138947063-138947085 CCCGAAGCACGACCCGCGTCTCT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809208_962809223 12 Left 962809208 3:138947046-138947068 CCCCCGCCCCCCGGTTTCCCGAA 0: 1
1: 0
2: 0
3: 23
4: 541
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809218_962809223 -6 Left 962809218 3:138947064-138947086 CCGAAGCACGACCCGCGTCTCTG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809207_962809223 13 Left 962809207 3:138947045-138947067 CCCCCCGCCCCCCGGTTTCCCGA 0: 1
1: 0
2: 1
3: 15
4: 238
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213
962809215_962809223 3 Left 962809215 3:138947055-138947077 CCCGGTTTCCCGAAGCACGACCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 962809223 3:138947081-138947103 TCTCTGGCGGAGCTGCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962809223 Original CRISPR TCTCTGGCGGAGCTGCCTCC TGG Exonic