ID: 962809226

View in Genome Browser
Species Human (GRCh38)
Location 3:138947099-138947121
Sequence CCTGGAGTCCCTAGTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962809221_962809226 1 Left 962809221 3:138947075-138947097 CCCGCGTCTCTGGCGGAGCTGCC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809217_962809226 13 Left 962809217 3:138947063-138947085 CCCGAAGCACGACCCGCGTCTCT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809222_962809226 0 Left 962809222 3:138947076-138947098 CCGCGTCTCTGGCGGAGCTGCCT 0: 1
1: 0
2: 1
3: 6
4: 125
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809209_962809226 29 Left 962809209 3:138947047-138947069 CCCCGCCCCCCGGTTTCCCGAAG 0: 1
1: 0
2: 0
3: 15
4: 375
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809216_962809226 20 Left 962809216 3:138947056-138947078 CCGGTTTCCCGAAGCACGACCCG 0: 1
1: 0
2: 0
3: 2
4: 21
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809215_962809226 21 Left 962809215 3:138947055-138947077 CCCGGTTTCCCGAAGCACGACCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809210_962809226 28 Left 962809210 3:138947048-138947070 CCCGCCCCCCGGTTTCCCGAAGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809211_962809226 27 Left 962809211 3:138947049-138947071 CCGCCCCCCGGTTTCCCGAAGCA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809213_962809226 23 Left 962809213 3:138947053-138947075 CCCCCGGTTTCCCGAAGCACGAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809214_962809226 22 Left 962809214 3:138947054-138947076 CCCCGGTTTCCCGAAGCACGACC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809218_962809226 12 Left 962809218 3:138947064-138947086 CCGAAGCACGACCCGCGTCTCTG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809208_962809226 30 Left 962809208 3:138947046-138947068 CCCCCGCCCCCCGGTTTCCCGAA 0: 1
1: 0
2: 0
3: 23
4: 541
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
962809212_962809226 24 Left 962809212 3:138947052-138947074 CCCCCCGGTTTCCCGAAGCACGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 962809226 3:138947099-138947121 CCTGGAGTCCCTAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962809226 Original CRISPR CCTGGAGTCCCTAGTGCGCC AGG Exonic