ID: 962811117

View in Genome Browser
Species Human (GRCh38)
Location 3:138960411-138960433
Sequence CCTCCACCCAGGAACCCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962811117_962811128 18 Left 962811117 3:138960411-138960433 CCGGCCGGGTTCCTGGGTGGAGG No data
Right 962811128 3:138960452-138960474 GGTGTTGTTCCAGGCCTGACGGG No data
962811117_962811129 26 Left 962811117 3:138960411-138960433 CCGGCCGGGTTCCTGGGTGGAGG No data
Right 962811129 3:138960460-138960482 TCCAGGCCTGACGGGTGTTCAGG No data
962811117_962811127 17 Left 962811117 3:138960411-138960433 CCGGCCGGGTTCCTGGGTGGAGG No data
Right 962811127 3:138960451-138960473 CGGTGTTGTTCCAGGCCTGACGG No data
962811117_962811131 27 Left 962811117 3:138960411-138960433 CCGGCCGGGTTCCTGGGTGGAGG No data
Right 962811131 3:138960461-138960483 CCAGGCCTGACGGGTGTTCAGGG No data
962811117_962811124 9 Left 962811117 3:138960411-138960433 CCGGCCGGGTTCCTGGGTGGAGG No data
Right 962811124 3:138960443-138960465 ACGTTTCCCGGTGTTGTTCCAGG No data
962811117_962811123 -3 Left 962811117 3:138960411-138960433 CCGGCCGGGTTCCTGGGTGGAGG No data
Right 962811123 3:138960431-138960453 AGGAAGGAAGGCACGTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962811117 Original CRISPR CCTCCACCCAGGAACCCGGC CGG (reversed) Intergenic
No off target data available for this crispr