ID: 962811636

View in Genome Browser
Species Human (GRCh38)
Location 3:138963370-138963392
Sequence CTGTGTAAACAGGAGGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962811636_962811640 -8 Left 962811636 3:138963370-138963392 CCATGCGCCTCCTGTTTACACAG No data
Right 962811640 3:138963385-138963407 TTACACAGGAAGCCCTGCTCTGG No data
962811636_962811644 16 Left 962811636 3:138963370-138963392 CCATGCGCCTCCTGTTTACACAG No data
Right 962811644 3:138963409-138963431 ATGCCACCTCCCTCTCCTGACGG No data
962811636_962811641 -7 Left 962811636 3:138963370-138963392 CCATGCGCCTCCTGTTTACACAG No data
Right 962811641 3:138963386-138963408 TACACAGGAAGCCCTGCTCTGGG No data
962811636_962811646 20 Left 962811636 3:138963370-138963392 CCATGCGCCTCCTGTTTACACAG No data
Right 962811646 3:138963413-138963435 CACCTCCCTCTCCTGACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962811636 Original CRISPR CTGTGTAAACAGGAGGCGCA TGG (reversed) Intergenic
No off target data available for this crispr