ID: 962817945

View in Genome Browser
Species Human (GRCh38)
Location 3:139019909-139019931
Sequence CGGGAGCGGCGAGCGCGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962817940_962817945 -4 Left 962817940 3:139019890-139019912 CCTTGCACGGAGGGCGTTCCGGG 0: 1
1: 1
2: 1
3: 5
4: 47
Right 962817945 3:139019909-139019931 CGGGAGCGGCGAGCGCGCGTGGG 0: 1
1: 1
2: 2
3: 10
4: 126
962817938_962817945 1 Left 962817938 3:139019885-139019907 CCGGGCCTTGCACGGAGGGCGTT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 962817945 3:139019909-139019931 CGGGAGCGGCGAGCGCGCGTGGG 0: 1
1: 1
2: 2
3: 10
4: 126
962817934_962817945 17 Left 962817934 3:139019869-139019891 CCTGGAACAGGCGTCTCCGGGCC 0: 1
1: 0
2: 3
3: 6
4: 97
Right 962817945 3:139019909-139019931 CGGGAGCGGCGAGCGCGCGTGGG 0: 1
1: 1
2: 2
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962817945 Original CRISPR CGGGAGCGGCGAGCGCGCGT GGG Exonic