ID: 962820541

View in Genome Browser
Species Human (GRCh38)
Location 3:139044312-139044334
Sequence GACCTCGGGGATCACGATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962820532_962820541 14 Left 962820532 3:139044275-139044297 CCTGCGCTCCTGAGCATTCGTCG 0: 1
1: 1
2: 0
3: 1
4: 29
Right 962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG 0: 1
1: 0
2: 2
3: 4
4: 45
962820534_962820541 6 Left 962820534 3:139044283-139044305 CCTGAGCATTCGTCGACGGAGCT 0: 1
1: 1
2: 1
3: 0
4: 17
Right 962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG 0: 1
1: 0
2: 2
3: 4
4: 45
962820529_962820541 30 Left 962820529 3:139044259-139044281 CCGGCAGACCAGTCGCCCTGCGC 0: 1
1: 0
2: 2
3: 6
4: 65
Right 962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG 0: 1
1: 0
2: 2
3: 4
4: 45
962820530_962820541 22 Left 962820530 3:139044267-139044289 CCAGTCGCCCTGCGCTCCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG 0: 1
1: 0
2: 2
3: 4
4: 45
962820531_962820541 15 Left 962820531 3:139044274-139044296 CCCTGCGCTCCTGAGCATTCGTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG 0: 1
1: 0
2: 2
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962820541 Original CRISPR GACCTCGGGGATCACGATGA GGG Exonic
902606174 1:17570566-17570588 GGCCTCAGAGATCAAGATGAGGG + Intronic
907466476 1:54641114-54641136 GACCTGGGGGAACAGGAAGATGG + Intergenic
907576961 1:55535120-55535142 GAGCTCGGGGTTCATGATGTGGG + Intergenic
1062792486 10:317683-317705 GACCCAGGAGATCATGATGAGGG - Intronic
1069512287 10:69051451-69051473 GACCACGGGGGCCACGATGAGGG - Intergenic
1069918698 10:71802990-71803012 CACCTCGGTCATCACCATGATGG + Exonic
1074377464 10:112951537-112951559 CAGGTCGGGGATCATGATGAAGG - Exonic
1084650565 11:70486955-70486977 GACCTGGGGGATGAGGATGTGGG - Intronic
1085030082 11:73265713-73265735 GACCCTGGGGACCACGAAGAAGG + Intronic
1089527611 11:119107542-119107564 GTCCTCGGGGGTCGCGATGCCGG - Exonic
1102513174 12:113429214-113429236 GCTCTCGGGGAGCACGATGGTGG - Exonic
1105698195 13:22911252-22911274 GACCTTGGGGATTTCGAGGAAGG + Intergenic
1108640327 13:52377733-52377755 GACCTTGGGGATCACCAGGCAGG - Exonic
1110630114 13:77697898-77697920 GCCCTCGGGGCCCACGATGATGG + Intronic
1113426293 13:110211175-110211197 GACCTCGGGCATCTGGATGTTGG - Intronic
1119465682 14:74856271-74856293 TCCCTCGGGGATCCCTATGAAGG - Intronic
1122884211 14:104703395-104703417 GTCCTCGGGGCCCAAGATGACGG - Exonic
1124580198 15:30946499-30946521 GACCCCGGAGCTCACTATGAGGG + Intronic
1129929901 15:79402067-79402089 GACCTCAGGGATCAGGAGGAAGG + Intronic
1132708981 16:1258276-1258298 GGCTTCGGGGGTCAGGATGAGGG - Intronic
1132841141 16:1979031-1979053 GAGCGCGAGGATCCCGATGAGGG - Exonic
1142688575 17:1591655-1591677 GACCACGAGGACGACGATGAAGG + Exonic
1149892755 17:60404713-60404735 GAACTCTGGGAACACAATGATGG - Intronic
1151825512 17:76521837-76521859 GACCTCGGGTTTCACAATGTTGG + Intergenic
1161470213 19:4453473-4453495 GGCCTCGGGGCTCCCGCTGACGG + Exonic
1168148736 19:54433737-54433759 GACATCAGGGATGAGGATGAAGG + Intronic
936955837 2:118021264-118021286 GACCTTGGGGACCACCAGGAGGG + Intergenic
939174973 2:138737853-138737875 TACCTCGGTGATCAACATGATGG + Intronic
1170164147 20:13344717-13344739 GCCCTCGGGGAACATGAGGAAGG - Intergenic
1170647960 20:18213468-18213490 GCCCACAGGGATCACCATGAAGG - Intergenic
1171406152 20:24913589-24913611 TACCTGGGGAATGACGATGAAGG + Intergenic
1171406174 20:24913685-24913707 TACCTGGGGAATGACGATGAAGG + Intergenic
1174634867 20:51990290-51990312 GTCCTTGAGGATCATGATGATGG + Intergenic
1181331678 22:22097799-22097821 GACCTGGGGGATCAGGATGCTGG - Intergenic
1181689049 22:24548191-24548213 GACCTAGGGTCTCATGATGAAGG - Intronic
1185397877 22:50601628-50601650 GAGCTTGGGGGTCAAGATGATGG + Intronic
951582073 3:24175355-24175377 GAACTCTGGGATAACGATCAAGG + Intronic
962816549 3:139005960-139005982 GACCTCTGGGATCAGGATGAGGG + Exonic
962818047 3:139020353-139020375 GACCTCTGGGATCAGGATGAGGG + Exonic
962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG + Exonic
968592884 4:1468045-1468067 GACCATGGTGATGACGATGATGG + Intergenic
979467827 4:121060792-121060814 GACCTTGGGGGTAAAGATGAGGG - Intronic
985673582 5:1218925-1218947 GGCCTCGGTGAAGACGATGAAGG - Exonic
1013281650 6:108643338-108643360 GACCTGGGGAATGAGGATGAGGG + Intronic
1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG + Intergenic
1019357530 7:588500-588522 GACAGTGGTGATCACGATGATGG + Intronic
1019357580 7:588800-588822 GACAGTGGTGATCACGATGATGG + Intronic
1034501778 7:151455311-151455333 GGCCTCGCGGTTCACGGTGAAGG - Intergenic
1037675927 8:21050709-21050731 GACCTCAGGGAGCACGCTGCCGG - Intergenic
1041095072 8:54341999-54342021 CCCCTCGGGGATAACGAGGAAGG + Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1192264519 X:69529743-69529765 GGCCTGGGGGATCATGATGGGGG - Exonic