ID: 962825375

View in Genome Browser
Species Human (GRCh38)
Location 3:139096016-139096038
Sequence CTGGTCAGCCAGATGTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 152}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962825367_962825375 15 Left 962825367 3:139095978-139096000 CCCAACATGTCCAGCCTGCAGTG 0: 1
1: 1
2: 4
3: 105
4: 1750
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825366_962825375 16 Left 962825366 3:139095977-139095999 CCCCAACATGTCCAGCCTGCAGT 0: 1
1: 1
2: 0
3: 28
4: 285
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825362_962825375 30 Left 962825362 3:139095963-139095985 CCACAGATCCAGCCCCCCAACAT 0: 1
1: 0
2: 1
3: 21
4: 218
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825363_962825375 22 Left 962825363 3:139095971-139095993 CCAGCCCCCCAACATGTCCAGCC 0: 1
1: 0
2: 6
3: 36
4: 355
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825364_962825375 18 Left 962825364 3:139095975-139095997 CCCCCCAACATGTCCAGCCTGCA 0: 1
1: 0
2: 3
3: 26
4: 361
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825365_962825375 17 Left 962825365 3:139095976-139095998 CCCCCAACATGTCCAGCCTGCAG 0: 1
1: 0
2: 2
3: 36
4: 319
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825368_962825375 14 Left 962825368 3:139095979-139096001 CCAACATGTCCAGCCTGCAGTGG 0: 1
1: 2
2: 3
3: 53
4: 593
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825370_962825375 5 Left 962825370 3:139095988-139096010 CCAGCCTGCAGTGGCTCCTCTGG 0: 1
1: 0
2: 2
3: 46
4: 366
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152
962825372_962825375 1 Left 962825372 3:139095992-139096014 CCTGCAGTGGCTCCTCTGGATTT 0: 1
1: 0
2: 2
3: 20
4: 195
Right 962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG 0: 1
1: 1
2: 0
3: 22
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962825375 Original CRISPR CTGGTCAGCCAGATGTGAAA AGG Intronic
902469464 1:16638462-16638484 GTGGGCAGCCAGGTGTGTAATGG - Intergenic
904511897 1:31017943-31017965 GTAGTAATCCAGATGTGAAATGG + Intronic
909027562 1:70500969-70500991 CTGGTCAGTCAGATGTACAGTGG - Intergenic
909325635 1:74348203-74348225 CTGGTTAGCCACATGTAGAAAGG - Intronic
909889370 1:80984536-80984558 CTGGCCTTCCAGATGTGAAATGG + Intergenic
911104692 1:94120669-94120691 CTGGACAGGCAGGTGTAAAACGG + Intronic
913612204 1:120519399-120519421 CTGGTTATCCAACTGTGAAAGGG + Intergenic
914578985 1:149002839-149002861 CTGGTTATCCAACTGTGAAAGGG - Exonic
915443787 1:155962922-155962944 CTCATCAGCCAGGTGGGAAAAGG - Exonic
915735424 1:158081654-158081676 CTGCTGAGCCAGCTGTTAAAGGG - Intronic
915901127 1:159847318-159847340 GAGGTCAGGCAGATGGGAAACGG + Intronic
922398174 1:225224046-225224068 CTGGTCAGTAAGATCTCAAAAGG + Intronic
922731461 1:227950580-227950602 GAGGGCAGCCAGACGTGAAAGGG - Intergenic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1064450414 10:15437025-15437047 CTTGCCAGCAAGATGTGAAAAGG - Intergenic
1064630135 10:17301801-17301823 CTGGTCACACAGGTGTGTAAAGG - Intergenic
1066820687 10:39483972-39483994 CTGGTTAGCCATATGTAGAAAGG + Intergenic
1074061652 10:109971735-109971757 TTGGTCAGCTAAATGTAAAAGGG + Intergenic
1074608659 10:115000042-115000064 TTGTTCAGACAGATGTGAAAAGG + Intergenic
1074807497 10:117068066-117068088 CTGGTCAGGCAGACGAGAAATGG + Intronic
1074855875 10:117473054-117473076 CTGTTCAGCGTGATGTGAAGTGG + Intergenic
1075806142 10:125190349-125190371 CTGGTCAGCAGGATGGGACAGGG - Intergenic
1079548285 11:21662342-21662364 CTGGGCATCCAGATGTGTTAAGG - Intergenic
1081198354 11:40187932-40187954 CTAGCCAGCCAGAAGTAAAAGGG + Intronic
1083652150 11:64209923-64209945 CTTGTCAGCCAGCTGGGAACTGG - Intronic
1084724947 11:70935434-70935456 GTGGTTAGCCAGGAGTGAAAGGG + Intronic
1085395041 11:76202913-76202935 CTGGGCAGTCAGGTGTGAAGGGG - Intronic
1087053205 11:93906561-93906583 CTGGGCTGCCCGATGTGGAATGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092282036 12:7105038-7105060 CTGGTCAACAAGCTGAGAAAAGG - Intronic
1093253519 12:16837696-16837718 ATGGTCAGGCAGATGGGCAATGG - Intergenic
1093857969 12:24128561-24128583 GTGGTGAGGCAGATGTGAGAAGG + Intergenic
1097610757 12:61816837-61816859 GTGTTCAGTCAGATGTGAGAAGG - Intronic
1102405764 12:112672895-112672917 CAGGTCAGCCAGAAGTGTCAAGG + Intronic
1103163548 12:118750961-118750983 GTGGTCAGACAGATGGGAAGTGG - Intergenic
1104069475 12:125331527-125331549 CTGGTGAGCCACATGTGAGCTGG - Intronic
1104417254 12:128605813-128605835 TTGGAGAGCGAGATGTGAAAGGG + Intronic
1106592885 13:31112119-31112141 CTGGTTAGCCAGGTAGGAAAGGG - Intergenic
1111655078 13:91141711-91141733 CTGGTCACCCAGAGGTGAAGTGG + Intergenic
1112277094 13:98031375-98031397 CTGGTCATACAGATGTTAGAAGG - Intergenic
1113593161 13:111514624-111514646 TTGGTCAGAAAGATGTGAAATGG + Intergenic
1114552290 14:23539738-23539760 TTGGTCAGCCAGAGGTGGGAGGG - Intronic
1118562348 14:67099654-67099676 TTGGTTAGCCTGATGTGAAGAGG - Intronic
1119562425 14:75601900-75601922 CTGGCCAACCAGCTGTGAATTGG + Intronic
1123801330 15:23823906-23823928 GTGGTCAGTCAGCAGTGAAATGG + Intergenic
1127727628 15:61765718-61765740 CTGCTCAGGCAGATCTGAAAAGG + Intergenic
1128128618 15:65211021-65211043 GTGGGCTGCCAGATGGGAAATGG - Intronic
1131097023 15:89662650-89662672 CTGGGCAACCCGATGTGAAGTGG + Intergenic
1131211383 15:90499860-90499882 CTTGTGTGCCAGATGTGAACTGG - Intronic
1133536173 16:6704462-6704484 CTGTTCAGCCTGCTGTGAAGAGG - Intronic
1134012411 16:10864963-10864985 CTGGTCAGCCACACTGGAAATGG + Intergenic
1135214344 16:20551824-20551846 CTGGTGAACCACATGTAAAAGGG - Intronic
1136121388 16:28137614-28137636 CTGGTCACCAAAATCTGAAATGG - Intronic
1140217569 16:73020790-73020812 CAGTTCAGCCAGATTTGAATAGG - Intronic
1140571198 16:76108306-76108328 CTGGTCAGCCAGAGGATACAGGG - Intergenic
1141059514 16:80852946-80852968 CTGGTCAGCCTCATGGGACAGGG - Intergenic
1141581761 16:85004233-85004255 CTGATCAGCTAGATGTGGAGAGG - Intronic
1143527723 17:7482151-7482173 CTGGTAAGCCATATGAGAAAGGG - Exonic
1144007984 17:11118619-11118641 ATGGTCAGGCAGATGTAAACTGG - Intergenic
1144849833 17:18238466-18238488 CTGCTCAGCCAGCTGTGCATTGG - Exonic
1145947443 17:28787617-28787639 GTGGTCTGCCAGGTGTGGAAGGG - Intronic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146731035 17:35194119-35194141 CTGGTAAGCCATACGAGAAAGGG + Exonic
1147235002 17:39050815-39050837 CGGGTCAACCATCTGTGAAATGG - Intergenic
1148190365 17:45674511-45674533 GTGATCAGCCAGGTGTGGAAGGG + Intergenic
1150479574 17:65499097-65499119 CTGGACTGCCACATGTGTAAGGG + Intergenic
1151222674 17:72624690-72624712 CTGGTCAGAAAGATGTAATATGG - Intergenic
1154115466 18:11609762-11609784 CTGGTAAGCCATACGAGAAAGGG - Intergenic
1156440069 18:37176480-37176502 GTGGAGAGCCAGAAGTGAAATGG - Intronic
1156812530 18:41270024-41270046 CTGATTTGGCAGATGTGAAAAGG - Intergenic
1160023581 18:75200758-75200780 CTGATAAGGCACATGTGAAATGG - Exonic
1160047563 18:75400894-75400916 CTCCACAGCCAGATGTGAAAGGG - Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1162958657 19:14113638-14113660 CAGGACAGCCAGATTTCAAAAGG - Intronic
1163670738 19:18626912-18626934 CTGGTCAGCCCAGTTTGAAAGGG + Intergenic
1164284359 19:23799786-23799808 CTTGTCAGGAAGATGTGAAAAGG + Intronic
1167731490 19:51260059-51260081 ATGGTCAGGCAGATGGGCAATGG + Intronic
1168227461 19:55006268-55006290 CTGCTCAGCCCGAAGTGAACAGG + Intergenic
927332402 2:21881099-21881121 CTGGTCAGCTTCATGAGAAATGG + Intergenic
927652054 2:24919171-24919193 CTGATCAGCTAGAACTGAAAAGG + Exonic
928338662 2:30422156-30422178 CTGCTTAGCCAGATTGGAAATGG + Intergenic
929418984 2:41771667-41771689 CTGGTGAAGCAGATGGGAAAGGG + Intergenic
937212760 2:120287149-120287171 GTGGTCAACCAGAGGTGAAAAGG + Intronic
938665319 2:133528905-133528927 CGAGACAGCCAAATGTGAAAGGG - Intronic
942093383 2:172515480-172515502 CTGGTCAGCAAGATCTCAAAAGG + Intergenic
942686962 2:178542884-178542906 CTGGTCTGCCAGCTGGGACATGG + Exonic
945391670 2:209272853-209272875 CTGGTAAGTCAGAGATGAAAGGG - Intergenic
946034493 2:216731082-216731104 CTGGTCAGCCAGAAGAGGAAAGG - Intergenic
946486403 2:220104866-220104888 GTGCTCTCCCAGATGTGAAAGGG + Intergenic
948044091 2:234929248-234929270 CTGGTCAGGAAGGTGGGAAAAGG + Intergenic
948810763 2:240476552-240476574 CTGTCCTGGCAGATGTGAAAAGG + Intergenic
1169905691 20:10600977-10600999 ATGGACAGACAGATGAGAAAAGG + Intronic
1170714125 20:18817480-18817502 GTGGTCAGGCAGGTGTAAAATGG - Intronic
1171878275 20:30598223-30598245 CTGTTCACCCAGCTGTGAATGGG - Intergenic
1173235552 20:41242369-41242391 CTTGTCAGCCAGATGTGCTGTGG - Intronic
1173940046 20:46903130-46903152 CTGGAGAGCCAGAGGTGAGAAGG + Intronic
1174137038 20:48386753-48386775 CTGGGCTGCCCGGTGTGAAAAGG + Intergenic
1175738095 20:61401009-61401031 CTGGAGGGCCAGGTGTGAAATGG - Intronic
1177940164 21:27400178-27400200 CAGCTCAGACATATGTGAAAGGG + Intergenic
1179177657 21:39020904-39020926 GTGGTCAGCGAGAGGAGAAAAGG + Intergenic
1180719052 22:17893284-17893306 CTGGTCAGCCACACGTGAGAGGG - Intronic
1181683696 22:24514229-24514251 CTGGTCAGGCAGATAAGAAATGG + Intronic
952323753 3:32301831-32301853 CTGGTTAGCCAGACTCGAAATGG - Intronic
953688890 3:45100557-45100579 CTGATCCAGCAGATGTGAAAGGG - Intronic
954299974 3:49695750-49695772 GTGGGCAGCCAGGTGTGTAATGG + Intronic
957413831 3:79874916-79874938 CTGAAGAGCCAGATTTGAAATGG - Intergenic
958633101 3:96705971-96705993 CTCTTGTGCCAGATGTGAAATGG - Intergenic
959781704 3:110241659-110241681 CTGGTCAGTCAGAAGGGCAATGG - Intergenic
962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG + Intronic
966225480 3:177593009-177593031 CTTGTGAGCCACATGGGAAAGGG + Intergenic
969234451 4:5855750-5855772 CTGGGCAGGCAGAGGAGAAAGGG + Intronic
972905935 4:43747194-43747216 CTGGTCAGTCAGAAGTTAGAAGG - Intergenic
973204630 4:47546500-47546522 CTTGGCAGCCAGGTTTGAAAGGG + Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984670775 4:182484429-182484451 CTGTTCTGTCAGCTGTGAAAGGG - Intronic
985144681 4:186883641-186883663 CTGATCTGATAGATGTGAAATGG + Intergenic
985174098 4:187183145-187183167 CTTGTCAGCAAAATGTTAAAGGG + Intergenic
985267516 4:188163830-188163852 CTGGTCAACCAAATGCAAAATGG - Intergenic
987233699 5:15921440-15921462 ATGGACAGACAGATCTGAAAAGG - Intronic
989079231 5:37599578-37599600 CTGGTTATCCATATGTAAAAAGG + Intronic
989218640 5:38930459-38930481 CAGGACAGCCAGATGTGAGGTGG + Intronic
990020324 5:51118657-51118679 CTGGTGAGCCTGAAGAGAAAAGG + Intergenic
993005816 5:82426965-82426987 CTGATGAGCCAGAGGAGAAAGGG - Intergenic
993028450 5:82673687-82673709 CTGGTCAGGAAGAGGTAAAAAGG + Intergenic
993515759 5:88832602-88832624 CAGATGAGCCAGATGTGAATAGG - Intronic
993913380 5:93711244-93711266 CTTGTCATTGAGATGTGAAATGG - Intronic
995704840 5:114977519-114977541 CTTGTAAGCCAGATGTTAAAGGG + Intergenic
995833568 5:116378706-116378728 GTGGTCAGTCAGCTGTAAAATGG + Intronic
997590135 5:135067256-135067278 TTGGAAAGCCAGCTGTGAAAGGG + Intronic
997824850 5:137097303-137097325 CAGGTCTGCCAAATGTGCAAGGG - Intronic
998637060 5:143967340-143967362 CTCATAAGCCACATGTGAAATGG + Intergenic
998772070 5:145556928-145556950 CTTGTCAGAGAGATGAGAAAAGG - Intronic
1001199878 5:169706455-169706477 CAGGTCACCCAGCTGTGAAATGG + Intronic
1002687510 5:181025061-181025083 CTGGTCTGCCAGATCTGAATGGG - Intergenic
1002961286 6:1917037-1917059 CTGAGGAGCCACATGTGAAAAGG - Intronic
1003303770 6:4908263-4908285 CTGGTTAACCTGATGGGAAAGGG + Intronic
1003941286 6:11029831-11029853 CTTGTAAGTCAGTTGTGAAAGGG - Intronic
1006133013 6:31879948-31879970 CTGGTCAGGAATGTGTGAAAGGG + Exonic
1007334209 6:41139982-41140004 CTGGTCAAGCAGGTGTCAAAAGG - Intergenic
1007659987 6:43477963-43477985 CTGGCCGGCCAGAGGGGAAAGGG + Intronic
1008674251 6:53802580-53802602 ATGGACAGCCAGATGTGTTAAGG + Intronic
1010437958 6:75857783-75857805 CTGTTCAACCAGAAATGAAATGG + Intronic
1012392157 6:98754521-98754543 CTGCTCAGCCAGGTGCTAAAAGG + Intergenic
1013614994 6:111834651-111834673 CTGGGCAGACAGATTAGAAATGG - Intronic
1014100678 6:117508594-117508616 CTGGTCAGCAAGACTGGAAATGG - Intronic
1014358529 6:120444418-120444440 CTGTTGAGGCAGAGGTGAAATGG + Intergenic
1022215539 7:28257147-28257169 CTGGTGAGAGAGATGAGAAAAGG - Intergenic
1022864331 7:34401432-34401454 CTGATCTGCCAGACGTGGAATGG - Intergenic
1023488220 7:40709683-40709705 CTGGTCAGGAAGATCTGAATGGG + Intronic
1024623814 7:51187560-51187582 ATGGGCAGGCAGAGGTGAAAAGG + Intronic
1034254293 7:149715843-149715865 CTGTGCAGCCAGACCTGAAAAGG - Intronic
1036481270 8:9141715-9141737 CAGATCAGACAGATGTGTAAAGG + Intronic
1036737500 8:11331273-11331295 CTGGTAAGCCATACGAGAAAGGG - Exonic
1037664206 8:20954116-20954138 CTGGTCATGCAGATGTGAGAGGG + Intergenic
1037752286 8:21690722-21690744 CAGTTCAGCCAGATGGGCAATGG + Exonic
1043763521 8:84099901-84099923 CCTGGCAGCCAGATGTGGAATGG - Intergenic
1048312588 8:133337096-133337118 CTGGTCACCCAGGTGGGAAATGG - Intergenic
1049527520 8:143135609-143135631 CTGGTGAGTCAGGTGTGCAAAGG - Intergenic
1049991552 9:996295-996317 CTGGTCTGACAAATTTGAAAAGG - Intergenic
1052151766 9:25126077-25126099 CTCCTCAGACAAATGTGAAAAGG + Intergenic
1056647698 9:88429209-88429231 CTGGTCACCCAAATGTGGGAAGG + Intronic
1056868561 9:90254526-90254548 CTGCTCTGACAGATGAGAAATGG + Intergenic
1057266756 9:93622417-93622439 CTGTTCAGCCAGCTGTGGATGGG + Intronic
1057800064 9:98185575-98185597 CTGGTCAGCCAGGTGTGAAAGGG + Intronic
1058773242 9:108259329-108259351 GTGGCCAGGCAGGTGTGAAAGGG - Intergenic
1061099956 9:128484950-128484972 GTGGTCAGCCAGATGGGTAGCGG + Intronic
1187022155 X:15394929-15394951 CTGGTCAACCAGTAGTCAAATGG + Intronic
1187698748 X:21945061-21945083 CAGGCCAGCCAGCTCTGAAAAGG + Intronic
1193554293 X:82933528-82933550 ATGGCAAGCCAGGTGTGAAAAGG - Intergenic
1194109947 X:89821267-89821289 CTGGTGAGGCAGTTGTGAAAGGG - Intergenic
1195559639 X:106268963-106268985 GTGGTCAGACAGATGGGCAATGG + Intergenic
1195562322 X:106297376-106297398 GTGGTCAGACAGATGGGCAATGG - Intergenic
1196160779 X:112479960-112479982 CAGGTCAGCCAGCTCTGCAAGGG + Intergenic
1196567479 X:117226376-117226398 CTTGTCAGTAAAATGTGAAAAGG + Intergenic
1198507336 X:137313740-137313762 GGGGTCAGCCAGATCTGAATCGG + Intergenic
1200462612 Y:3476005-3476027 CTGGTGAGGCAGTTGTGAAATGG - Intergenic