ID: 962827734

View in Genome Browser
Species Human (GRCh38)
Location 3:139112164-139112186
Sequence GGAGGCACAAAGTGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962827734_962827740 1 Left 962827734 3:139112164-139112186 CCTGGCCCACACTTTGTGCCTCC 0: 1
1: 0
2: 4
3: 24
4: 311
Right 962827740 3:139112188-139112210 CTTCTCTGGAATTTTTCCTTAGG 0: 1
1: 0
2: 2
3: 40
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962827734 Original CRISPR GGAGGCACAAAGTGTGGGCC AGG (reversed) Intronic
900681018 1:3916247-3916269 GGAGGCAGAAAGCTTGGGCTTGG + Intergenic
900803094 1:4749558-4749580 GGAGGCACACTGTGGAGGCCAGG + Intronic
901149814 1:7093734-7093756 CGAGGCACAGGGTGTGTGCCTGG + Intronic
901655553 1:10767349-10767371 GGAGGCCCAAAGCCTGGGACGGG + Intronic
902110259 1:14072477-14072499 GGAGGCACAGAGTGTTGGAGAGG - Intergenic
902678730 1:18028323-18028345 GGAGGCAGAGAGTGAGAGCCTGG + Intergenic
902865092 1:19272922-19272944 GCAGGCACATAGTGAGGGCTGGG - Intergenic
902867182 1:19287521-19287543 GCAGGCACATAGTGAGGGCTGGG - Intronic
903261536 1:22134185-22134207 GGAGGCTCTAAATGTGGCCCAGG - Intronic
903650084 1:24916866-24916888 GGAGGGACAGAGGCTGGGCCTGG - Intronic
904490675 1:30857136-30857158 GGAGGCAAGAAGAGGGGGCCAGG - Intergenic
904891651 1:33783971-33783993 GGAGTCACATGGTGGGGGCCGGG - Intronic
905922704 1:41729938-41729960 GGAGGCACAAAGGCAGGGCAGGG + Intronic
906108290 1:43307493-43307515 GGAGGCAGAAGGTGAGGCCCCGG - Exonic
906520715 1:46465369-46465391 GGAACCACACAGTGGGGGCCGGG + Intergenic
906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG + Intronic
906565699 1:46799515-46799537 TGAGGCCCAAAGTTTGGACCAGG + Intronic
906566392 1:46804151-46804173 GGAGGAACAAAGAGTGGGTGAGG + Intronic
906660562 1:47578503-47578525 GGAGGGACAGAGGGAGGGCCCGG + Intergenic
906724109 1:48031132-48031154 GAAGGCCCAGAGTGTGGGTCTGG - Intergenic
906858644 1:49334804-49334826 GGAGGGACAAAGAGGGGTCCAGG + Intronic
907888777 1:58618625-58618647 GTGGGCACAATTTGTGGGCCAGG - Intergenic
910086303 1:83406798-83406820 AGAGGCACAAAGCATGGGCAGGG + Intergenic
912466315 1:109877316-109877338 GGGGGCACAAGGTGGGGGCAGGG - Intergenic
912680799 1:111727583-111727605 GGGGGAACAGACTGTGGGCCTGG + Exonic
913063139 1:115226070-115226092 GAAGGCACGCACTGTGGGCCTGG + Intergenic
913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG + Intergenic
913219228 1:116645974-116645996 TGGGGCACAAAGTGGGAGCCAGG + Intronic
915549975 1:156626067-156626089 TGGGGCACATAGGGTGGGCCTGG - Intergenic
916395939 1:164387262-164387284 GGAGACAGGAATTGTGGGCCTGG - Intergenic
916858300 1:168774763-168774785 GGATGAGAAAAGTGTGGGCCAGG - Intergenic
917188522 1:172388673-172388695 GGAGCCCCAGAGTGGGGGCCAGG - Exonic
918207939 1:182325932-182325954 GGAGGAAGAGAGAGTGGGCCGGG - Intergenic
920522154 1:206635707-206635729 GGAGGCACAGCTCGTGGGCCTGG + Exonic
920970719 1:210741669-210741691 GGAGGCACATTCTGTGGGCCAGG - Intronic
922225915 1:223645827-223645849 GGAGGCACAAAGAGTCCTCCTGG + Intronic
922478987 1:225925423-225925445 GGGTGCACAAACTGAGGGCCTGG - Intergenic
1067087676 10:43251417-43251439 GGAGGCACAAAGGCTGGAGCAGG + Intronic
1068392877 10:56422305-56422327 TGAGGTACAAAGTGTGACCCAGG + Intergenic
1069560751 10:69427657-69427679 AGAAGGACAAACTGTGGGCCTGG - Intergenic
1070325405 10:75385452-75385474 GGCGGCCCAAAGCCTGGGCCAGG + Intergenic
1070833058 10:79432057-79432079 GGGAGCACAGAGTGTGGGGCAGG + Intronic
1071573958 10:86712375-86712397 GGAGGCAGGAAAGGTGGGCCAGG + Intronic
1072828627 10:98634235-98634257 GGATGCACAAAGCGAGGGGCAGG - Intronic
1073139910 10:101240155-101240177 GGAGGCACAGACTGTGTGGCAGG + Intergenic
1075427509 10:122353297-122353319 GGACTCCCAAAGTGTGAGCCAGG - Intergenic
1075637894 10:124042747-124042769 GGAGGGACAAAGTCTGGGGCTGG + Intronic
1076341411 10:129748831-129748853 GATGGCAGAAAGTGTGAGCCAGG - Intronic
1077286419 11:1767949-1767971 GGAGGCAGGAGGTGGGGGCCAGG + Intergenic
1077329728 11:1978894-1978916 GGAGGAACAAAGGCAGGGCCTGG + Intronic
1077387035 11:2274743-2274765 GAAAGCACCAAGTGTGGGCGGGG - Intergenic
1077429875 11:2511122-2511144 GGAGGCACGTAGTGTGTGCCTGG - Intronic
1077512635 11:2977335-2977357 GGAGGCACAGGGTGTTGGCTCGG - Intronic
1082090171 11:48082525-48082547 GGAGGCTCAAAGGGTGAGGCAGG - Intronic
1082092089 11:48098375-48098397 CGAGGCTCACAGAGTGGGCCAGG + Intronic
1083187733 11:61027178-61027200 GGAGGCAGTGATTGTGGGCCTGG - Intergenic
1083441058 11:62676891-62676913 GGAGGAACTAGGTGGGGGCCAGG - Exonic
1083576758 11:63797495-63797517 AGAGGCACCAGGTGTGGGCCAGG + Intergenic
1084234429 11:67777575-67777597 TGAGGCAGAAACTGTGGGCAGGG + Intergenic
1084422187 11:69066001-69066023 GGAGGTACACAGTGTGGGGTGGG + Intronic
1084640591 11:70423647-70423669 GGAGGGGCGAGGTGTGGGCCTGG + Intronic
1087682413 11:101231844-101231866 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1088732840 11:112698488-112698510 GGAGGCAGCAAGTGTGGGGTGGG - Intergenic
1089647531 11:119889971-119889993 GGAGGCAAGAAGTGAAGGCCAGG - Intergenic
1090301655 11:125646622-125646644 GGAGGCAGTAAGTGTTGGCAAGG - Intronic
1090630088 11:128638114-128638136 GGAGCCACAAAGTGTAGGGCTGG - Intergenic
1091102152 11:132885032-132885054 GAAGGCACAGCGTGTGGTCCAGG - Intronic
1202812706 11_KI270721v1_random:34073-34095 GGAGGAACAAAGGCAGGGCCTGG + Intergenic
1091914002 12:4254744-4254766 AGATGCTCAAAGTCTGGGCCGGG + Intergenic
1096273450 12:50185306-50185328 GGAGGCACACACTGTGGGAGGGG + Intronic
1096570030 12:52517319-52517341 GGTGGCAAATAGTGTGGGGCTGG + Intronic
1098582909 12:72121941-72121963 GGAGGCACAGAGAGCTGGCCTGG - Intronic
1099190889 12:79561392-79561414 GGAGGCACCAAGAGTGAGCAAGG - Intergenic
1099855240 12:88156300-88156322 GGATGAACAAAGAGTGGCCCTGG - Intronic
1101397165 12:104358501-104358523 GAAGCCACACAGTGTGAGCCTGG - Intergenic
1101886263 12:108665728-108665750 GGAGGCACTATGTGTGTGTCTGG - Intronic
1102996170 12:117352265-117352287 GGAGGCAAGAGGCGTGGGCCTGG + Intronic
1103938415 12:124488864-124488886 GGAGGCCCGAAGTGGGGGCTGGG + Intronic
1104404069 12:128502837-128502859 GGCGGCACCCAGTTTGGGCCGGG + Intronic
1107865754 13:44701666-44701688 GGAAGCACAAAGTGTGGGAAAGG - Intergenic
1110371147 13:74741910-74741932 GGTGGCAAAAAGTGTGGATCTGG - Intergenic
1111743086 13:92229187-92229209 TGAGGTACAAAGTGTGTGGCTGG + Intronic
1113315632 13:109176627-109176649 GAAGGGACAAAGTGACGGCCAGG - Intronic
1114566289 14:23635652-23635674 GGAGGCACCAAGAGTGAGCAAGG - Intronic
1114643098 14:24237733-24237755 TGAGACTCCAAGTGTGGGCCAGG + Intronic
1114657574 14:24325291-24325313 GAAGGAAGAAAGTGTGGCCCGGG + Intronic
1117542544 14:56762253-56762275 GGAGGCAATAAGTGTGGGCCGGG + Intergenic
1118325070 14:64774965-64774987 GGAGGCACCAAGGGAGGGCAGGG + Intronic
1119207324 14:72804246-72804268 GGAGGCACGCAGTGTGGATCTGG - Intronic
1119329442 14:73783251-73783273 GGAGGCCCACAGGGTGGGACAGG + Intronic
1119572482 14:75687925-75687947 GAAAACACCAAGTGTGGGCCAGG + Intronic
1121319148 14:92981042-92981064 GGGGGCTCCAAGGGTGGGCCAGG - Intronic
1121340020 14:93099648-93099670 TGAGGCACAAGGTGGGGTCCAGG + Intronic
1121765182 14:96479827-96479849 GGAGGCCCAAGGTGTGGGCCTGG - Intronic
1122514604 14:102298070-102298092 GCAGGCACATGGTGTGGGACTGG + Intronic
1122881851 14:104693834-104693856 GGGGGCACAGAGGGTGGGGCAGG - Intronic
1123043688 14:105500931-105500953 GGAGGCCCACGGTGTCGGCCTGG + Intergenic
1123403430 15:20006718-20006740 GCAGGCACAGAGCGTGGGCTGGG - Intergenic
1123512768 15:21013372-21013394 GCAGGCACAGAGCGTGGGCTGGG - Intergenic
1124031708 15:26018093-26018115 GGGGGCACCAACTGTGTGCCAGG + Intergenic
1124350151 15:28949320-28949342 GGAGGCAGCAAGTCAGGGCCGGG + Intronic
1124372171 15:29110190-29110212 GGAGGCACACAGGCAGGGCCTGG - Intronic
1125674121 15:41493659-41493681 GTAGGCACAAAACCTGGGCCCGG - Intronic
1126409828 15:48361815-48361837 GGAAGGACAAAGTGGGGGCATGG - Intergenic
1128688344 15:69704109-69704131 GGAGACATAAATTGTGGTCCTGG - Intergenic
1129153750 15:73704757-73704779 GCAGCCACAAGGTGTGGCCCAGG + Intronic
1129586925 15:76876321-76876343 GGAGGCACCAAGAGTGAGCGAGG + Intronic
1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG + Exonic
1134762528 16:16726902-16726924 GGAGGCACAAAGGGAGGGGAGGG - Intergenic
1134983525 16:18632252-18632274 GGAGGCACAAAGGGAGGGGAGGG + Intergenic
1135256314 16:20944389-20944411 AGAGGCAGAGAGTGGGGGCCTGG - Intronic
1136480550 16:30539072-30539094 GGAGGCAAAAAGTTTGGGAGGGG + Intronic
1138688694 16:58748702-58748724 GGAGGCACCAAGGGTGAGCGAGG - Intergenic
1139955934 16:70693024-70693046 GGAGGCAGGCAGTGTGGGCTGGG - Intronic
1141811744 16:86380535-86380557 GGAGGCACAGCGTGTGTTCCAGG + Intergenic
1142280656 16:89146028-89146050 GGGAGCTCAAAGAGTGGGCCAGG + Exonic
1142751975 17:1994389-1994411 GGAGGGACCAAGTGTGTCCCTGG - Intronic
1144366445 17:14549359-14549381 GGAGGAAGCAAGTGTTGGCCTGG - Intergenic
1144743672 17:17598737-17598759 GGAGGCAAAAAGGCTGGGCACGG + Intergenic
1146127957 17:30243865-30243887 TGAGGGACAAAGTGCGGGACAGG + Intergenic
1146263353 17:31435793-31435815 CCAGGCACCAACTGTGGGCCAGG + Intronic
1147150603 17:38511530-38511552 GGGGGCGCAAAGTGGGGACCAGG - Exonic
1147339542 17:39745496-39745518 GGAGGCTCTGAGTGTGGCCCTGG + Exonic
1148737774 17:49874454-49874476 GGAGGCACAGGGTCTGGGTCAGG + Intergenic
1148990844 17:51666013-51666035 GGAGTCACAAAGTGGCTGCCAGG - Intronic
1150788187 17:68179700-68179722 GGAGGCGCCAAGAGTGAGCCAGG - Intergenic
1151662559 17:75526288-75526310 GGAGGCACAAAGGGCCGGCAGGG - Intronic
1152765969 17:82139014-82139036 AGAGGCAAAAAGTGTGGGGCAGG - Intronic
1155866777 18:30974868-30974890 GGAGACAGAAAGTGGGGGGCGGG + Intergenic
1156092359 18:33487180-33487202 GGAGGCTCAAAGCGTGGGACAGG + Intergenic
1157443145 18:47725314-47725336 GGAGGTACCAAGTGTGGTACTGG - Intergenic
1157815562 18:50727399-50727421 GGAGGCACTGAGGGAGGGCCAGG + Intronic
1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG + Intergenic
1158104516 18:53870768-53870790 GGTGGCACAGAGTGTGGGACTGG - Intergenic
1160177051 18:76603488-76603510 GGAGGCACAGCGTGAGTGCCGGG + Intergenic
1160586221 18:79915003-79915025 TGCGGCACAAAGGCTGGGCCTGG + Intronic
1161237172 19:3203933-3203955 GGAGGCACAGAGGGAGGGCCGGG + Intronic
1162363081 19:10231161-10231183 GGAGGCAGAAAAGGCGGGCCTGG - Intronic
1162765326 19:12915852-12915874 TGAAGCAGAAAGTGTGGGCAGGG - Intronic
1163432782 19:17278248-17278270 GAAGGATCAAAGTGGGGGCCAGG + Intronic
1163593090 19:18205118-18205140 GGAGACCCAAAGTGGGGGCTGGG - Intergenic
1163667341 19:18609575-18609597 CAAGACACAGAGTGTGGGCCAGG - Intronic
1164801859 19:31083588-31083610 GGAGGCACAAAGTGTGGAGCGGG + Intergenic
1165392616 19:35547090-35547112 GGAGGCAGAAAGTCGGGGCCAGG - Intronic
1165900019 19:39165007-39165029 GGAAGCACAAAGTGGGCCCCGGG - Intronic
1165984864 19:39759086-39759108 GGGGTCACAAAGTGTGATCCAGG + Intergenic
1166377364 19:42335117-42335139 GGTGGCACAACGTGAGTGCCAGG + Exonic
1166854773 19:45778054-45778076 GAAGGCACAGAGTGTGGGAGCGG - Intronic
1167476512 19:49704672-49704694 GGAGACACACAGTGAGGGGCTGG - Intronic
1167724617 19:51201616-51201638 GGAGGCCCTAAGTGGGGGCAGGG + Intergenic
925085033 2:1101157-1101179 GGAGGCACAGAATGCGAGCCTGG - Intronic
926093624 2:10066191-10066213 GGAGGCAGCAAGTCTGGCCCTGG - Intronic
926286873 2:11495711-11495733 GGACACACACAGTTTGGGCCCGG + Intergenic
927672902 2:25083814-25083836 GCAGACTCAAAGTGTGGTCCTGG + Intronic
927776202 2:25905475-25905497 TGAAGCAAATAGTGTGGGCCAGG - Intergenic
930027109 2:47035749-47035771 GGAGGCAGGAATTGTGGCCCAGG + Intronic
930842727 2:55865211-55865233 GGAGGTAGAAATTGAGGGCCAGG + Intergenic
931163973 2:59725338-59725360 GCAGCCAAAAAGTGTGTGCCAGG - Intergenic
934608936 2:95720321-95720343 GGAGGCACAAGGCCTGGGGCAGG + Intergenic
934617705 2:95785157-95785179 GGAGGAAGACAGAGTGGGCCTGG + Intergenic
934643188 2:96039402-96039424 GGAGGAAGACAGAGTGGGCCTGG - Intronic
935403264 2:102682388-102682410 GGAGGCACATGGTGTGTGCCGGG + Intronic
938604032 2:132873910-132873932 TTAGGCACCTAGTGTGGGCCGGG + Intronic
939013783 2:136877842-136877864 GAAGGCAAAAACTGTGGGCAGGG + Intronic
943669751 2:190648751-190648773 GGAGGAACCAAGTGGGCGCCGGG - Intronic
946492992 2:220168018-220168040 GGAAGGACAAAGGCTGGGCCAGG + Intergenic
946967644 2:225054713-225054735 GGAGTCTCACTGTGTGGGCCAGG - Intergenic
947371743 2:229453684-229453706 GGAGGCAGAAAGGGTGGGGTAGG - Intronic
947722469 2:232378326-232378348 GGAAGCACACAGTCTGGGCCAGG - Intergenic
947985853 2:234446849-234446871 GGAGGCACACAGGGAGTGCCCGG - Intergenic
948388554 2:237596649-237596671 GGAGGCTGGATGTGTGGGCCAGG + Intronic
948456679 2:238107726-238107748 GGAGGCACACAGAGTGGGAGGGG - Intronic
948751882 2:240137794-240137816 GGAGGAACACAGTGCGGGACGGG - Intergenic
948832567 2:240605310-240605332 GAAGGGACAAAGGGTGGCCCTGG + Intronic
1168911060 20:1447204-1447226 GGACTCAAAAAGTGTGGGCTGGG + Intronic
1168998826 20:2151934-2151956 CCAGGCACAGGGTGTGGGCCAGG - Intronic
1169112827 20:3044592-3044614 GGAGGAAGAAAGTGATGGCCGGG + Intronic
1169192559 20:3667414-3667436 GGAGGCACTAGGTTTGGTCCAGG - Intergenic
1169327243 20:4686326-4686348 GGGGGCACAGAGTGTGCGCCGGG + Exonic
1171232743 20:23500516-23500538 GGAGGCAAGAGGGGTGGGCCTGG + Intergenic
1172271867 20:33659555-33659577 GAGGGCACAGAGTGTGGGCCGGG + Exonic
1172846027 20:37930441-37930463 GGAGGGACAGGGTGGGGGCCAGG + Intronic
1173259200 20:41418422-41418444 TGAGGAACGAAGTGAGGGCCAGG + Intronic
1173761217 20:45562264-45562286 AGAGACACAAAGTGTGTGCAGGG + Intronic
1175161365 20:57010085-57010107 GGAGGCACAAGGCTGGGGCCTGG - Intergenic
1175941033 20:62537618-62537640 GGAGGCAGGAAGGGTGGCCCAGG + Intergenic
1175981615 20:62741515-62741537 GGAGGAACATGGTGTGGGGCAGG - Intronic
1176067397 20:63205389-63205411 GGAGGCAGGAAGTGGTGGCCGGG - Intronic
1176344897 21:5733964-5733986 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176351711 21:5854548-5854570 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176499930 21:7590491-7590513 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1176539218 21:8132034-8132056 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176558169 21:8315079-8315101 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176663152 21:9659887-9659909 GGAGGCACAGAGAGCGAGCCAGG - Intergenic
1176872320 21:14093478-14093500 GGAGGCACCGAGAGTGAGCCAGG + Intergenic
1178239425 21:30881831-30881853 TGAGGGACAACGTGTGGGCTGGG - Intergenic
1179553578 21:42158926-42158948 GAGAGCACAAAGTGTGGGGCCGG - Intergenic
1180089316 21:45525693-45525715 GGGGGCACAGGGTGCGGGCCTGG - Intronic
1180711500 22:17842416-17842438 GGAGGCACCTGGTGGGGGCCTGG - Intronic
1180820520 22:18824030-18824052 TGGGGCACAAAGTGGGAGCCAGG + Intergenic
1180868402 22:19132872-19132894 AGAGGGAGACAGTGTGGGCCTGG - Exonic
1181104510 22:20565897-20565919 GGAGGCACCAAGTGTGTGCCTGG - Intronic
1181206744 22:21258502-21258524 TGGGGCACAAAGTGGGAGCCAGG + Intergenic
1181680966 22:24495542-24495564 GGGGCCACAGAGTGTGGGTCTGG + Intronic
1183315937 22:37136790-37136812 GGAGGCAAAAAGAGTGACCCAGG - Intronic
1183470949 22:38006460-38006482 GCAGGCACATACTGTGTGCCAGG + Intronic
1183509102 22:38224773-38224795 GGACGCACAAGGTATGAGCCAGG - Exonic
1183990280 22:41593378-41593400 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1184012208 22:41757635-41757657 AGAGGAAGAAACTGTGGGCCAGG - Intronic
1185155782 22:49192625-49192647 TGGGGCTCAAAGTGTGAGCCAGG + Intergenic
1185177139 22:49334390-49334412 GGGGGCACAGGGTCTGGGCCTGG - Intergenic
1203220180 22_KI270731v1_random:36921-36943 TGGGGCACAAAGTGGGAGCCAGG - Intergenic
1203244167 22_KI270733v1_random:48389-48411 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1203270646 22_KI270734v1_random:49905-49927 TGGGGCACAAAGTGGGAGCCAGG + Intergenic
949371989 3:3345132-3345154 GGAGCCAAAAAGTGTAGTCCAGG - Intergenic
949897447 3:8778772-8778794 GGAGGCAGATAGGGTGGGCCAGG - Intronic
950524876 3:13517732-13517754 GGAGGCACATGGTGGGGTCCGGG + Intergenic
953959886 3:47258652-47258674 GGAGGAAGAAAGTGAGGGGCAGG - Intronic
954085931 3:48243949-48243971 GGAGGCACATCGTGAGGTCCTGG + Intronic
956538937 3:70312566-70312588 GGAGGCCCAAGGTGTGGGACTGG + Intergenic
960968432 3:123121681-123121703 GAAGGCACCAAGTGGGGGCCAGG + Intronic
961268867 3:125672123-125672145 GCCGGCACACAGTGTGGGACTGG + Intergenic
961481874 3:127186041-127186063 GGAGTCTCAAACTGTGGCCCAGG + Intergenic
961576641 3:127842246-127842268 GGAGTCACAGAGAGTGGGGCTGG - Intergenic
961648341 3:128404661-128404683 TGGGGCACAGAGTGTGGGCATGG - Intronic
962827734 3:139112164-139112186 GGAGGCACAAAGTGTGGGCCAGG - Intronic
965139184 3:164814103-164814125 GGAGGCACACAGAGTGAGCAAGG - Intergenic
966548910 3:181183009-181183031 GCAGACGCAAAGTGTGGGACTGG - Intergenic
966706416 3:182920750-182920772 GGCGGAGCAAAGTATGGGCCAGG + Exonic
967243332 3:187462782-187462804 GAAGTCACAGAGTGTGGGCCAGG + Intergenic
967963611 3:194943723-194943745 GGAGGGGCAAAGTGTGGGAGGGG - Intergenic
967995651 3:195164465-195164487 GAAGGAACAAAGTGTGAGGCAGG - Intronic
968211226 3:196850505-196850527 GGAGGAACTGAGTGGGGGCCAGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968654200 4:1771654-1771676 GGGGGCTGGAAGTGTGGGCCAGG + Intergenic
968878201 4:3285426-3285448 TGAGGGACAAAGGGTGTGCCAGG + Intergenic
969230353 4:5826399-5826421 AGAGGGACAAGGAGTGGGCCAGG + Intronic
969736350 4:8993356-8993378 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
972505857 4:39719010-39719032 GGAGGCACCAAGAGTGAGCAAGG + Intronic
974089957 4:57300677-57300699 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
974129052 4:57730398-57730420 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
977854454 4:101872608-101872630 GGAGAAACACAGTGTGGGCTAGG - Intronic
979498404 4:121411198-121411220 GGAGGAACAAGTTGTGGGCAGGG + Intergenic
983004717 4:162469673-162469695 GGAGGCAGAATGTGTGGGATGGG - Intergenic
984884052 4:184434317-184434339 AGATGATCAAAGTGTGGGCCGGG - Intronic
985412170 4:189696162-189696184 GGAGGCACAGAGAGCGAGCCAGG + Intergenic
985622553 5:963082-963104 GGAAGCTCCAAGGGTGGGCCTGG - Intergenic
987920491 5:24273472-24273494 GTAGTTAGAAAGTGTGGGCCGGG - Intergenic
988827348 5:34951441-34951463 ATGGGCACAAAGAGTGGGCCAGG + Intronic
989511911 5:42297815-42297837 TGAGGCACAAAGTGTTTGTCAGG - Intergenic
991329320 5:65476273-65476295 TGAGCCACAAAGTGTTGGCAAGG - Intronic
992715628 5:79508740-79508762 GGAGACACAAAGTGTGTGTTGGG - Intronic
995842009 5:116451383-116451405 GAAGGCACGAAGTTTGGACCTGG - Intronic
996852561 5:127968659-127968681 GGAGTCACAAAGTTTTGCCCAGG + Intergenic
998448375 5:142215952-142215974 GGAGGGACACCTTGTGGGCCTGG - Intergenic
998691689 5:144594985-144595007 GGAGGCACCAAGGGTGAGCAAGG - Intergenic
999321082 5:150615432-150615454 GGAGGCAGAAGGAGTGGGCGTGG - Intronic
1000251497 5:159499966-159499988 TGAGGCACTAATTGTGTGCCAGG + Intergenic
1000898726 5:166888178-166888200 AGATACACAAAATGTGGGCCAGG - Intergenic
1001033193 5:168277671-168277693 GGAAGCACACAGTGTGGACACGG - Intergenic
1001772384 5:174305999-174306021 TGAGGCAGAAAGTCTGGGCCAGG + Intergenic
1002181125 5:177431621-177431643 GCAGGCAGCAGGTGTGGGCCTGG + Intronic
1002189176 5:177469929-177469951 GGAGGCAGAAAGGGAGGGCAAGG + Intronic
1005752375 6:28895543-28895565 TGAGACACAGAGTGTGAGCCTGG + Intergenic
1006267057 6:32934420-32934442 GGAGTCACAGAGTATGGGCAAGG - Intergenic
1008230959 6:48984287-48984309 GCAGGCACACAGTGTGGGACTGG + Intergenic
1009873104 6:69472935-69472957 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1010686591 6:78860358-78860380 CAATGCACAAACTGTGGGCCAGG - Intergenic
1011497425 6:87950368-87950390 GGAGGGAGAAAATGTGGGCAAGG - Intergenic
1012537249 6:100313663-100313685 AAAGGTACAAATTGTGGGCCAGG - Intergenic
1013536386 6:111066710-111066732 GGTGGAACACAGTGTGGCCCAGG - Intergenic
1014273702 6:119363350-119363372 GGAGGAATAAACGGTGGGCCTGG + Intergenic
1014299624 6:119665533-119665555 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1014795430 6:125719082-125719104 GGAGGCAGAAAGGGTGGGAAAGG + Intergenic
1016388975 6:143556326-143556348 CCAGGCACAAGGCGTGGGCCAGG + Intronic
1017017853 6:150116139-150116161 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1017970766 6:159310821-159310843 GGAGGGTCAAAGTGTCGGTCAGG + Intergenic
1018607316 6:165611475-165611497 GAAGGCACACGGTGTGGCCCTGG - Intronic
1019989831 7:4683169-4683191 GGAGCCGCAAGGTGTGGGTCAGG - Intronic
1020023672 7:4883733-4883755 GGGGCCACAAAGGGTGGGGCGGG + Intergenic
1021513889 7:21461752-21461774 GGAGGCACCGAGAGTGAGCCAGG + Intronic
1021520645 7:21536566-21536588 GCAGGCACATGGTGTGGGACTGG - Intergenic
1022265355 7:28748377-28748399 GGAAGAACAATGTGTGGGCAAGG + Intronic
1022727533 7:32994680-32994702 GGAGGTACAAATTTTGGGGCTGG - Intronic
1023453552 7:40313885-40313907 GAAAAAACAAAGTGTGGGCCAGG - Intronic
1024064217 7:45719133-45719155 GGAGGCAGACAGGGTGGGCTGGG + Exonic
1025046053 7:55692969-55692991 GGAGGTACAAATTTTGGGGCTGG + Intergenic
1026236875 7:68534964-68534986 GCAGGCACAAGGCGTGGGACTGG - Intergenic
1027303181 7:76863262-76863284 AGAGGCACAAAGCATGGGCAGGG + Intergenic
1028229715 7:88292133-88292155 TGAGGGACCAAGTGTGGGTCAGG + Intronic
1031253069 7:119413327-119413349 GCAGGCACAAAGCGCGGGACTGG - Intergenic
1031902793 7:127429017-127429039 GGAGGCACCAAGAGTGAGCGAGG - Intronic
1033058735 7:138084760-138084782 AGAATTACAAAGTGTGGGCCGGG + Intronic
1033256154 7:139803659-139803681 GGCTGCACACAGTGGGGGCCTGG - Intronic
1034926931 7:155130023-155130045 GAAGGCACCAAGGGTGGGGCAGG + Intergenic
1035417183 7:158699538-158699560 AGGGGCACAATGTGTGGCCCAGG - Intronic
1035732376 8:1862161-1862183 CCAGGCAGGAAGTGTGGGCCAGG - Intronic
1037611718 8:20481524-20481546 AGAGGCACAAAGGGTGGGAGAGG - Intergenic
1037646000 8:20793335-20793357 GGAGGCCCAGAGTGTGGGAGAGG - Intergenic
1037889525 8:22616203-22616225 TGAGGCACAGAATGAGGGCCCGG + Exonic
1038805087 8:30783020-30783042 GGATAAACAAAGTGTGGGCCAGG - Intronic
1039628121 8:39077385-39077407 GAAGGCACAAAATGTGGTGCTGG + Exonic
1039917460 8:41870707-41870729 GCTGGCAGAAAGGGTGGGCCCGG + Intronic
1040047571 8:42979064-42979086 GGAGTCTCAATGTGTTGGCCAGG - Intronic
1040493589 8:47947056-47947078 GGAGGTACACAAAGTGGGCCAGG - Intronic
1040953941 8:52961247-52961269 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1048116882 8:131533162-131533184 GGAGGCACACTGTGTGGCCAAGG - Intergenic
1049172145 8:141168155-141168177 GGAGGTACAAATAGCGGGCCAGG - Exonic
1049237465 8:141519286-141519308 GGAGGCAGCAAGTGAGGGGCAGG - Intergenic
1049400303 8:142423713-142423735 GAAGGCAGAAAGTGGAGGCCAGG - Intergenic
1049424751 8:142533045-142533067 GGAGGGGCAGAGTGTGGGACAGG + Intronic
1051314112 9:15810376-15810398 GCAGGCACACAGTGTGGGACTGG - Intronic
1053514300 9:38716948-38716970 GAAAGCACACAGTGTGGGGCAGG - Intergenic
1055736452 9:79336152-79336174 AGAGCCACAAAGGGTGGGGCTGG + Intergenic
1056124922 9:83526576-83526598 GGAGGCACCAAGTGCAGGCTGGG - Intronic
1056602784 9:88059431-88059453 TGAGGCACAAAGTGTAACCCAGG + Intergenic
1059164402 9:112064538-112064560 TGGGGCACAAAGTGTAGGCGTGG + Intronic
1060247975 9:121962357-121962379 GGAGGCACAAGTGGTGGGTCAGG - Intronic
1061554428 9:131358235-131358257 GGAGTCAGAAAGTTGGGGCCGGG + Intergenic
1061577997 9:131519659-131519681 AGGGCCACAAGGTGTGGGCCAGG - Intronic
1061705542 9:132450359-132450381 TGGGGCAAAAAGTGGGGGCCTGG + Intronic
1061747703 9:132752623-132752645 GGAGGAACAAGGTGGGGGCAGGG - Intronic
1062003756 9:134229298-134229320 GGAGGAAGATGGTGTGGGCCAGG + Intergenic
1062433727 9:136536930-136536952 GGAGGCACACAGTGGGGCCGCGG - Intronic
1062536351 9:137022735-137022757 GGAGGCCCTCAGTGCGGGCCCGG - Exonic
1203460498 Un_GL000220v1:31476-31498 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1203662947 Un_KI270753v1:61878-61900 GGAGGCACAGAGAGCGAGCCAGG + Intergenic
1203670424 Un_KI270755v1:6819-6841 GGAGGCACAGAGAGCGAGCCAGG - Intergenic
1189636342 X:43014322-43014344 TGAGGAAGAAAGTGTGGGACAGG - Intergenic
1195430138 X:104779855-104779877 GGAGGTACAAAGTGGGGGTGGGG + Intronic
1198087385 X:133293915-133293937 GGTGGGACAAAGTGTGGTCTGGG - Intergenic
1199938541 X:152601383-152601405 GCAGGCAGAAAATGTGGGGCTGG + Intergenic
1200383475 X:155865227-155865249 GGAGGCACCAAGAGTGAGCAAGG - Intergenic
1200684074 Y:6244826-6244848 GGAGGCACATGGGGTGAGCCAGG - Intergenic
1200955254 Y:8938190-8938212 GGAGGCACAGAGAGTGAGCAAGG - Intergenic
1201048561 Y:9909560-9909582 GGAGGCACATGGGGTGAGCCAGG + Intergenic
1202271568 Y:23078848-23078870 GGAGGCACCGAGAGTGAGCCAGG + Intergenic
1202294458 Y:23341834-23341856 GGAGGCACCGAGAGTGAGCCAGG - Intergenic
1202424563 Y:24712592-24712614 GGAGGCACCGAGAGTGAGCCAGG + Intergenic
1202446226 Y:24957493-24957515 GGAGGCACCGAGAGTGAGCCAGG - Intergenic