ID: 962832731

View in Genome Browser
Species Human (GRCh38)
Location 3:139158573-139158595
Sequence CTGGGGGCACAGGGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 0, 2: 7, 3: 62, 4: 658}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962832717_962832731 30 Left 962832717 3:139158520-139158542 CCATGGAGTAAATTGTAATTGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG 0: 1
1: 0
2: 7
3: 62
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962832731 Original CRISPR CTGGGGGCACAGGGGGAGAA GGG Intronic
900539881 1:3197328-3197350 CTGGGGGCACACAGGAAGGAGGG - Intronic
900541488 1:3205162-3205184 CCGGGGGGCCAGGGGCAGAAGGG + Intronic
900570856 1:3357554-3357576 CTGGGGGCCCGTGGGGGGAACGG - Intronic
900760308 1:4466092-4466114 CTGGGGGCAGAGGGTGGGCATGG + Intergenic
900809042 1:4787314-4787336 CTGGGGGCAGAGAAGGAGAGAGG + Exonic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900998858 1:6137477-6137499 CTGGGGGGAGTGGGGGATAAAGG - Intronic
901125362 1:6925114-6925136 CAGGGGGCCCAAGGGCAGAAGGG + Intronic
901162514 1:7190125-7190147 CTCGGGGGAAAGGGTGAGAAGGG + Intronic
901680509 1:10910153-10910175 CTGGGGGCCCTGGGGCAGGATGG + Intergenic
901739528 1:11333221-11333243 CTGGCGGTACAGGGGCAGAAAGG - Intergenic
901775980 1:11560658-11560680 CTGGGGGAACAGGGGGATCGGGG + Intergenic
902363959 1:15958804-15958826 CTGAGGGGCCAGGTGGAGAAGGG + Intronic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902610110 1:17592279-17592301 CTGAGGTCACAGGGGGATAAAGG - Intronic
902668350 1:17954714-17954736 CTGGGGGCACAGGGGTCGGGGGG - Intergenic
902782992 1:18716586-18716608 GTGGTGGCACAGGGGGCGAAGGG - Intronic
902943055 1:19814366-19814388 CCGGGGGCCCAAGGGCAGAAAGG + Exonic
903811128 1:26035651-26035673 TTGGGGGCGGAGGGGGAGGAGGG - Exonic
904752833 1:32751638-32751660 CTGGGGGAAGAGGGGGTGCAAGG + Intronic
904771821 1:32885174-32885196 TTGGGGGCAAGGTGGGAGAAGGG - Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905357731 1:37396457-37396479 CTGGGGGCAGAGGGAGAGAGTGG + Intergenic
905859843 1:41342846-41342868 CTGGGGTCACAGAGAGGGAATGG - Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
907267619 1:53272423-53272445 TGGGGGGCAGAGGGGGAGAGGGG - Intronic
907461955 1:54610379-54610401 CTGGGAGCACCGGGGCTGAAGGG + Intronic
909169731 1:72280928-72280950 GTGGGGTGGCAGGGGGAGAAGGG + Intronic
909428745 1:75560682-75560704 CTTGGGGCACAGGGAGGCAAAGG - Intronic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
911576056 1:99579954-99579976 CTGGTGGATAAGGGGGAGAATGG - Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
912237832 1:107871325-107871347 GTGGGGGGAGAGGGGGGGAATGG - Intronic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
915004645 1:152624437-152624459 GTGGGGGCAGAGGGGTAGAGTGG + Intergenic
915234906 1:154473475-154473497 TTGGGGGGACAGGGGTCGAAGGG + Intronic
915282987 1:154835398-154835420 GTGGGGGCAGAGGGCGGGAAGGG - Intronic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915527697 1:156486219-156486241 CTGGGGTCACAGGTGAGGAATGG - Intronic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
915827641 1:159095420-159095442 CTGAGGGCTCAGGAAGAGAAAGG + Intronic
915973129 1:160367703-160367725 CTGGGGCCAGATGGGGAGCACGG + Intronic
916069953 1:161164141-161164163 CTGGGGGAAAAGGGGAAGAAAGG - Intronic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916705316 1:167343157-167343179 GTGGGGGTCAAGGGGGAGAAGGG + Intronic
917120818 1:171643223-171643245 TTGCCTGCACAGGGGGAGAAGGG - Intronic
917840236 1:178971573-178971595 CTGAGGGGAGAGGGGGAGAGGGG - Intergenic
918294947 1:183147736-183147758 ATGGGAGCATAGGTGGAGAAAGG - Intergenic
918474198 1:184905587-184905609 CAGGGGACTTAGGGGGAGAAAGG - Intronic
918516498 1:185369398-185369420 CTGGGGCCAGAGTGGTAGAAAGG + Intergenic
920107660 1:203565784-203565806 CCTGGGGCACAGGAAGAGAAGGG - Intergenic
920188576 1:204177911-204177933 CTGAGAGCAGAGGGAGAGAAAGG - Intergenic
920430443 1:205915268-205915290 CTGGGGTCACAGGGGGTGTCGGG - Intronic
920758634 1:208760254-208760276 CTGGGAGAAATGGGGGAGAAAGG + Intergenic
920836644 1:209517259-209517281 TTGGGAGCACAGGAGGAGAAAGG - Intergenic
922362283 1:224834122-224834144 CCAGGGGCACAGGAGGAGGAAGG - Intergenic
922362791 1:224838601-224838623 GTGGGGGCACAGGGGGAGTCAGG - Intergenic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922507243 1:226133634-226133656 CTGGAGGCAAATGGGGAGCAGGG + Intergenic
922565127 1:226596752-226596774 CTGAGGGCACTGGGAGACAAAGG - Intronic
923106647 1:230858918-230858940 AGGGGGTCACAGGAGGAGAAAGG + Intronic
923512670 1:234665975-234665997 ATGGGGGCACTGGGGGATGAGGG - Intergenic
923802676 1:237225668-237225690 CTGGGGGTAAAGGGAGTGAATGG + Intronic
924321588 1:242855910-242855932 CTCTGGGGACTGGGGGAGAAGGG - Intergenic
924894190 1:248317856-248317878 ATGAGGGCACAGTGGGAGTACGG + Intergenic
1062998142 10:1888019-1888041 TTGGGGGGAAAGGGTGAGAAAGG - Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1065359391 10:24875398-24875420 CTGGGGGCAGCAGGGGAGAATGG - Intronic
1066012730 10:31209442-31209464 CTGGCAGCAGAGAGGGAGAAAGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066602865 10:37126085-37126107 CTGGGGGGCCTGGGGAAGAAGGG + Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1066994236 10:42549194-42549216 CTGGGAGCACAGCGGGGAAAAGG + Intergenic
1067080390 10:43209255-43209277 CTGGGAGCATAGGGGGTGACTGG - Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067702171 10:48581922-48581944 ATGGGGGCACAGGGGTGAAAAGG - Intronic
1067920054 10:50445998-50446020 CTGGGAGCACTAGGGGAGATGGG - Intronic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1071177072 10:82939245-82939267 GTGGGGGTGCAGGGGAAGAAAGG + Intronic
1071911110 10:90234870-90234892 TTGGGGGCTCAGGGGGAAAAGGG + Intergenic
1072528381 10:96295126-96295148 AGGAGGGCACAGGGAGAGAAGGG - Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073486183 10:103820510-103820532 GAGGGGGCACTGGGGGAGGAGGG - Intronic
1073678583 10:105677790-105677812 CTGGGAGCACTGTGGGAGACTGG - Intergenic
1074486876 10:113893112-113893134 CCAGGGGTACAGGGAGAGAAAGG + Intronic
1074781357 10:116804521-116804543 CTGGGGGTAAAGGGAGAGGAAGG - Intergenic
1075041780 10:119113583-119113605 TTGGGGGCACTGAGGGTGAAGGG + Intronic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075744769 10:124719238-124719260 GTGGGGGAACAGGAGAAGAAAGG + Intronic
1075909032 10:126107629-126107651 CTGTGGGGACAGTGTGAGAAGGG - Intronic
1076317617 10:129553690-129553712 CTGGAGGCACAAGGAGAGAGTGG + Intronic
1076403912 10:130200316-130200338 CTGGGGGCTCAGGAGGGGAGGGG - Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076595709 10:131623370-131623392 GTGGGGGCAGAGGTGGAGAGAGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076833178 10:133007128-133007150 GTGGGGGCACAGGGGGCTCAGGG + Intergenic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1078067334 11:8086996-8087018 GTGGAGGCAGAGGAGGAGAAAGG + Intronic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1080368086 11:31600897-31600919 ATGGGGGTACAGGAGGAAAACGG - Intronic
1080693936 11:34584449-34584471 AGGGGGGAACAGGGGAAGAATGG + Intergenic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1082783452 11:57303610-57303632 CTGGGGGCATAAAGGCAGAAAGG - Intronic
1083470676 11:62881777-62881799 GAGGGGGCAAAGGGGGAGAGAGG - Intronic
1083491447 11:63017408-63017430 AGGGGGGCCCAGGAGGAGAATGG - Intergenic
1083540307 11:63507574-63507596 CTGGGAGCTCAGGGGAAGAAAGG + Intronic
1084063031 11:66687975-66687997 ATGGGGGCACAGAGGGACAGTGG + Intronic
1084180500 11:67443403-67443425 CCGGGGGCACCGGGGGCGCAGGG + Exonic
1084188933 11:67490222-67490244 CTGGAGGCTGAGGGGGAGGATGG + Intronic
1084219114 11:67666820-67666842 CCGGGGCCTCAGGGGCAGAAGGG + Intronic
1084644203 11:70445198-70445220 AGGGGGGCACAGGAGGAGGAAGG + Intergenic
1084857908 11:72000634-72000656 CTGGTGGTACATGGGCAGAAGGG - Intronic
1084915763 11:72428023-72428045 CTGGGGGCAGTGGGGGTAAAGGG - Intronic
1085040810 11:73325241-73325263 CTAGGGGCCCAGAGGGAGACAGG - Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1088365127 11:109032407-109032429 TTGGGGGCAGAGGGGCACAATGG - Intergenic
1088586975 11:111367923-111367945 CTGGGGTCACCGGAGCAGAAAGG + Intronic
1089340140 11:117751722-117751744 ATGGAGGCTCAGGGGGTGAAAGG + Intronic
1089381575 11:118036579-118036601 CTGGGGGTGCCTGGGGAGAAGGG + Intergenic
1089770191 11:120797034-120797056 CTTGGGGCTCATGGGGAGAAAGG + Intronic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091370607 11:135055036-135055058 CTGGGAGCTCAGGTGGAGAATGG - Intergenic
1091699447 12:2650497-2650519 CTGCGGGCACCGGGAGAGAATGG - Intronic
1092159919 12:6310620-6310642 CTCGGGGCAGAGGGGCAGAGGGG - Intronic
1093307293 12:17537019-17537041 TTGGAGGCGCAGGGGGAGAGGGG - Intergenic
1094218900 12:27972912-27972934 CTGGGGGGACGGGGGGGGGAGGG - Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1095975127 12:47935140-47935162 CTGAGGGCACGGGGGCAGGAGGG + Intronic
1096188318 12:49598632-49598654 CTGCGGGACCAGGGGCAGAAGGG - Intronic
1097182854 12:57180831-57180853 CTGGGGGCTCAGGGGCAACAGGG + Intronic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1100276893 12:93079746-93079768 TGGGGGGAAGAGGGGGAGAATGG + Intergenic
1101499341 12:105287968-105287990 ATGGGGGCACAGAGAGTGAAGGG + Intronic
1101800680 12:108019358-108019380 CTGGGGGCACACGTGCAGTAAGG - Intergenic
1101886103 12:108663919-108663941 GCCTGGGCACAGGGGGAGAAAGG + Intronic
1102046270 12:109832247-109832269 TTGGGGGAACAAGGGTAGAAAGG - Intronic
1102366012 12:112335365-112335387 TTGGGGACTCAGGGGGAAAAGGG + Intronic
1102474084 12:113177380-113177402 CTGGGGGCACTGTGGGTGGAAGG - Intronic
1102719052 12:115000849-115000871 GTGGGGGGAGAGGGAGAGAAAGG + Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103251775 12:119506146-119506168 CTGGGGGCTCTGGGTAAGAAGGG - Intronic
1103999947 12:124854149-124854171 CTGGCAGCACAGGGGGACAAGGG + Intronic
1104298202 12:127538295-127538317 CTGGGTGCACAGTAAGAGAACGG + Intergenic
1104482176 12:129117257-129117279 CTAGGGGTTCAGGGGGAGGAGGG + Intronic
1104604717 12:130179680-130179702 CTGGGGGCAGAGAGGAAGAGAGG - Intergenic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105587863 13:21761325-21761347 CTCGGGCCACAAGCGGAGAATGG - Intergenic
1107065895 13:36214297-36214319 CTCGGGGCGCCGGGGGAGAGTGG + Intronic
1108094003 13:46881201-46881223 CTGTGGGCAGAGGAGGGGAAGGG + Intronic
1110221578 13:73079839-73079861 AGGAGGGCACTGGGGGAGAATGG + Intergenic
1110734464 13:78919713-78919735 CAGAAGGCAAAGGGGGAGAAAGG - Intergenic
1112252128 13:97792158-97792180 TTGGGGGGCCAGGGGCAGAATGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112639789 13:101260005-101260027 CTGGGGGGACGGGGGGAGGCAGG - Intronic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1113126107 13:106981481-106981503 CAGTGGGCTCAGGGGGAGAGGGG - Intergenic
1113464464 13:110503945-110503967 CCTGGGGCACCGGGGGAGATGGG + Exonic
1113629191 13:111869426-111869448 CTTGGGGCACAGGAAGAGGATGG - Intergenic
1113742985 13:112724135-112724157 ATAGGGGCAAAGGGGGTGAAGGG - Intronic
1113788212 13:113014095-113014117 CTGGGAGCACGGGGGGAGCATGG - Intronic
1114254303 14:20988744-20988766 ATGGGTGGACAGGGGGAGAAGGG - Intergenic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1114475241 14:22989688-22989710 GTGGGAGGAGAGGGGGAGAAAGG + Intronic
1114716303 14:24829057-24829079 GTGGGGGCACAGGGGGCACAGGG - Intronic
1114725242 14:24929828-24929850 CTGGGATCAGAGGGGAAGAAGGG - Intronic
1115480907 14:33860213-33860235 GTGGGGGGACAGGGGAAGGAAGG - Intergenic
1117538432 14:56723775-56723797 TTGGGGGCACAGGGGATAAAGGG + Intronic
1117875616 14:60248562-60248584 CTGGGGTCACTGGGAGAGGAAGG + Intronic
1118642872 14:67808548-67808570 GTGAGGGTACAGGGAGAGAAGGG + Intronic
1118835350 14:69473954-69473976 CTAGGGGCAGAGGGTGGGAATGG + Intergenic
1119658498 14:76434303-76434325 CTGGAAGCAGAGGGGGAGAGAGG - Intronic
1120723852 14:87916470-87916492 ATGGAGGTACAGCGGGAGAAAGG + Intronic
1121034310 14:90687511-90687533 CTGGGGGAAGAGGGTGAGAATGG + Intronic
1121093968 14:91202865-91202887 CGGGGGCCACAGGAGGAGACTGG - Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121813679 14:96913099-96913121 CTGTGGGCAGATGGGGGGAAAGG + Intronic
1122022914 14:98854108-98854130 TTAGGGACTCAGGGGGAGAATGG - Intergenic
1122386603 14:101352612-101352634 CTTGGGGCATTGGAGGAGAAAGG - Intergenic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1123025506 14:105421851-105421873 CTGCGGGCACAGGGGGACAGAGG - Intronic
1123699569 15:22904194-22904216 CAGCGGGCACATGGGGGGAAGGG - Intronic
1124959440 15:34383587-34383609 GTGGGGGCAGAGAGGGAGATGGG - Intronic
1124976066 15:34529808-34529830 GTGGGGGCAGAGAGGGAGATGGG - Intronic
1125361890 15:38873195-38873217 CTGGAGGCAGTGGGGAAGAAGGG - Intergenic
1125374420 15:39013463-39013485 CTGGCGGCAGTGGGAGAGAATGG + Intergenic
1125828099 15:42692800-42692822 CTGGAGGCACAGGGTGGGTAAGG - Exonic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1126408619 15:48348970-48348992 CTGGGGGCAAAGGGAGACCAGGG + Intergenic
1126675444 15:51156286-51156308 TGGGGGGCACAGGGGGTGCAGGG + Intergenic
1126816346 15:52459003-52459025 TTTGGGGGGCAGGGGGAGAAGGG + Intronic
1127372979 15:58357545-58357567 CTGGGGCCCCAAGAGGAGAATGG + Intronic
1127485334 15:59413119-59413141 CACGTGGCAAAGGGGGAGAAGGG + Intronic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1128223389 15:65984080-65984102 CTTGGGGCACAGATGAAGAAGGG - Intronic
1128757552 15:70193825-70193847 GAGGGGGAGCAGGGGGAGAAGGG + Intergenic
1128861980 15:71081833-71081855 CTAGTGGCACAGGAGGAGCATGG + Intergenic
1129106073 15:73308133-73308155 CAGGGGGCAAAGGGGGACACAGG + Intergenic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1129271549 15:74421761-74421783 CTGGGGGCTAAGGGGCAGGAGGG + Intronic
1129276061 15:74446064-74446086 CTGGGGGTTCAGGGGAAGCAGGG + Exonic
1130862307 15:87901764-87901786 AGGGGGGGAGAGGGGGAGAAAGG + Intronic
1130990835 15:88874772-88874794 GTGCAGGGACAGGGGGAGAAGGG + Exonic
1132013925 15:98299754-98299776 TGGTGGGCACAGGAGGAGAAGGG - Intergenic
1132310326 15:100852898-100852920 GTGGGGGCTCAGGGGGAGGGTGG - Intergenic
1132561933 16:599233-599255 CTGGTGGCACAGGCAGAGAAGGG - Intronic
1132855501 16:2042917-2042939 CTGCGGGGACAGGAGGGGAATGG - Intronic
1133393802 16:5430121-5430143 CTGGGGGGATACAGGGAGAAGGG + Intergenic
1134241939 16:12512975-12512997 CTGGGGGGACAAGGGAAGCAAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134779768 16:16885239-16885261 CTGGGAGGAAATGGGGAGAAAGG - Intergenic
1135607593 16:23836932-23836954 CTGGAGGGACTGGGGAAGAAAGG - Intronic
1135825644 16:25725336-25725358 CCGGGGGCTAAGGGGAAGAAAGG - Intronic
1136037201 16:27549585-27549607 CTGGGGGCAGGGCGGGGGAATGG - Intronic
1136618468 16:31412731-31412753 ATGGTGGCAAAGGGAGAGAAGGG - Intronic
1137236895 16:46624490-46624512 CTGGGGTCACATGGTCAGAAGGG - Intergenic
1137715527 16:50595990-50596012 TCGGGGGCTCAGGGGGAGCAGGG - Intronic
1137718071 16:50611089-50611111 CTTGGGCCCCACGGGGAGAATGG + Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1138495336 16:57405442-57405464 TTGGGGGCAGATGGGGAGATGGG + Intronic
1139273373 16:65704159-65704181 CTGAAGGCAGAGGAGGAGAAAGG - Intergenic
1139653807 16:68375655-68375677 CTGGGATCACAGCAGGAGAAAGG - Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1139973456 16:70790793-70790815 CTGGGGCCACAGGGCCTGAATGG - Intronic
1140166539 16:72558276-72558298 CTGGGGGCAGCGGGGGAGACTGG + Intergenic
1140457765 16:75114776-75114798 CTGAGGGCACCGTGGGAGCAGGG - Intronic
1140474652 16:75233788-75233810 CTGGGGGCTCAGGGGGTCAGCGG + Intronic
1141233281 16:82191355-82191377 TTGGGGGGAAGGGGGGAGAAGGG - Intergenic
1141400678 16:83744514-83744536 CAGGGGACAGATGGGGAGAACGG - Intronic
1141440540 16:84026867-84026889 CTGCGGGCAGAGGTGGAGAATGG + Intronic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141988049 16:87592861-87592883 CTGAGGGCACTGTGGGGGAAGGG + Intergenic
1142872137 17:2827887-2827909 GTGGGGGCCCAGGGGGAGCGTGG + Intronic
1143013898 17:3881553-3881575 CTGGGGACACAGGGAGGGAAAGG + Intronic
1143280487 17:5750679-5750701 TTGGGGGCACAGAGGCAGAGAGG - Intergenic
1143564193 17:7711760-7711782 TTGGGGACTCATGGGGAGAAGGG + Intergenic
1143564445 17:7713032-7713054 CTGGGAGGACAGGGTGAGTAAGG + Intergenic
1143628468 17:8123938-8123960 CTGGGGACGCAGGGGTGGAAGGG - Intronic
1143754586 17:9057128-9057150 CTGCGGGGTGAGGGGGAGAAGGG - Intronic
1143850321 17:9806398-9806420 AGGGTGGCACAGGGAGAGAATGG + Intronic
1144742205 17:17590313-17590335 CAGGAGGCACAGGAGGAGATGGG - Intronic
1144807167 17:17975771-17975793 CGGAAGGCACAGGTGGAGAAGGG + Intronic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147052967 17:37810855-37810877 CTGGGGACTCAAGGGGAAAAGGG - Intergenic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147139232 17:38452237-38452259 CTGGGGGCAGAGGGAGGGGAAGG - Intronic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147242677 17:39100845-39100867 CTGGGAGCGCAGGGGGCTAAGGG + Intronic
1147339275 17:39744291-39744313 TGGGGGGCCCAGGGGGAGAAGGG - Intronic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148080991 17:44967750-44967772 GTGGGGCCGCCGGGGGAGAAGGG - Exonic
1148102858 17:45103309-45103331 AGTGGGGCAGAGGGGGAGAAGGG - Intronic
1148483955 17:47978591-47978613 CTGGGTTCAGAGGGGTAGAAAGG - Intronic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148688971 17:49515812-49515834 CTGGGGGCGTAGGAGGGGAATGG - Intergenic
1149291870 17:55225421-55225443 CAGAGGGCACAGGAGGAGCAGGG - Intergenic
1150417137 17:64996799-64996821 CTGGGGACAGAGTGGCAGAATGG - Intergenic
1150431548 17:65122479-65122501 TTGGAGGTACAGGGGTAGAAAGG - Intergenic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150794527 17:68227123-68227145 CTGGGGACAGAGTGGCAGAATGG + Intergenic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151723149 17:75869716-75869738 CTGGGAGGAGAGGGGGTGAAGGG + Intergenic
1152307502 17:79529831-79529853 CTGGGGGAACTGGGGGAGCTGGG - Intergenic
1152430526 17:80246220-80246242 CTGCGGGCACAAGGGGAAGATGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153759188 18:8313739-8313761 CTCAGGGGAAAGGGGGAGAAGGG - Intronic
1154138170 18:11799197-11799219 CTGGGGACACATGGGGATATGGG - Intronic
1154396099 18:13990772-13990794 CAGGAGGCAAAGGGGGAGCAAGG - Intergenic
1154525720 18:15288032-15288054 CTGGGAGCACTGCGGGAGACTGG - Intergenic
1155595699 18:27483427-27483449 CTGGGAGCACAGGGAGACAAGGG - Intergenic
1156223951 18:35083568-35083590 CTGGGAGCACAGGGCAGGAATGG - Intronic
1156452231 18:37273410-37273432 CTAGGGGCAGAGGAGGAGACTGG + Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1157270882 18:46275137-46275159 CTGGGGGCTGATGGGGGGAATGG + Intergenic
1159333190 18:67029014-67029036 CTGGAGGCTGAGGAGGAGAATGG - Intergenic
1160118961 18:76109816-76109838 GTGAGGGCACAGTGGGAAAATGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160673345 19:376757-376779 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160673390 19:376863-376885 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160673442 19:376992-377014 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160673495 19:377121-377143 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160673570 19:377304-377326 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160673633 19:377459-377481 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160673644 19:377486-377508 GTGGGGGCACAGAGGGGGAGAGG - Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160804244 19:984787-984809 ATGGGGGCAGTGGGGGAAAATGG + Intronic
1160950996 19:1667410-1667432 CTGAGGTCACAGGGAGAAAACGG - Intergenic
1160979632 19:1811093-1811115 CTGGTGCCACATGGGGAGAGGGG - Intronic
1161122130 19:2534533-2534555 ATGAGGCCACAGGGTGAGAAAGG - Intronic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1161951789 19:7471604-7471626 CTGCCAGCACAGTGGGAGAAGGG - Exonic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162841052 19:13356696-13356718 CTGGGAACTCAGGGAGAGAATGG - Intronic
1163004408 19:14388627-14388649 AAGGGGGCACTGGGGGAGATGGG - Intronic
1163017106 19:14463338-14463360 CTGGGAGCACATGTGGGGAATGG + Intronic
1163063055 19:14774107-14774129 AAGGGGGCACTGGGGGAGATGGG + Intronic
1163531092 19:17849239-17849261 GTGGGGGGACAGGGGGATCAGGG + Intergenic
1163636148 19:18437989-18438011 CTGGGGGCCCGGGGTGAGCAGGG + Intronic
1164508063 19:28875526-28875548 GAGGAGGCACACGGGGAGAATGG - Intergenic
1164590751 19:29505477-29505499 CAGGGGTCAGAGGTGGAGAATGG - Intergenic
1164617715 19:29676779-29676801 CAGAGGGCACAGGGTGAGACAGG + Intergenic
1164618420 19:29680172-29680194 CTGGGGGCATCGGGGTAGAGAGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164779480 19:30880862-30880884 CAGGGGGCACAGGGAGAGGTGGG + Intergenic
1165372638 19:35419031-35419053 GGAGGGGGACAGGGGGAGAAGGG + Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1165894999 19:39136219-39136241 GTGGGGACAGTGGGGGAGAAGGG - Intronic
1166383628 19:42368672-42368694 CTTTGGGCACTGGGGGAGAGGGG + Intronic
1166782355 19:45349213-45349235 CGTGGGGCACAGGGTGAGATGGG - Intronic
1166831747 19:45643545-45643567 CTGCGGGAAAAGGGGGAGAGGGG - Intronic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167571296 19:50290596-50290618 CTGGGGGCACTGGGGAACCATGG + Intronic
1167594823 19:50422115-50422137 CTGGGGGCTCCGGAGGTGAAGGG - Intronic
925426426 2:3752105-3752127 CTGGGGTCCCAAGAGGAGAAAGG - Intronic
925645993 2:6037454-6037476 CTGGGGGCTCTGGGTGAAAACGG + Intergenic
925741664 2:7010234-7010256 GTGGAGGCACTGGGAGAGAAAGG + Intronic
926159460 2:10477447-10477469 CTGGCAGCACAGGGGCAGACAGG + Intergenic
926337476 2:11875192-11875214 GTAGGGGCACAGGGGGCGGAGGG - Intergenic
926588747 2:14717730-14717752 CAGGCAGCAGAGGGGGAGAAGGG - Intergenic
927899997 2:26812292-26812314 TTGAGGGCACAGGAGGAGTATGG - Intergenic
928105559 2:28468614-28468636 CTGGGGGCACAGGGTGCCAGTGG + Intronic
928328650 2:30339924-30339946 CTGAGGGCAAAGGGGAAGTAAGG - Intergenic
929688154 2:44052237-44052259 ATGGGGCCACAGGGGGAACAGGG + Intergenic
929826287 2:45311414-45311436 CTGAGGGGACTCGGGGAGAATGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
931705814 2:64945156-64945178 CATGGGGCACAGGGGTGGAACGG + Intergenic
933244556 2:79961297-79961319 CTGGGGCTACAGGGAGACAAAGG - Intronic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936438737 2:112531551-112531573 CCGGGGGTACAGGGGAAGAGTGG - Exonic
937317383 2:120940607-120940629 CTGGGGTCACAGAGAGAGAATGG - Intronic
937983302 2:127627364-127627386 CTGGGGGCTCGGGGAGAGATGGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938114246 2:128592420-128592442 GTGGGGGGCCAGGGGGAGCAAGG + Intergenic
938152050 2:128895432-128895454 CTGGGGGCTCCAGGGGAGGAGGG + Intergenic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
938387337 2:130876207-130876229 CTGGGGGCACAGGCGGCCTAGGG + Intronic
938444389 2:131366425-131366447 CTGGGGGAGCAGGGAGAGAATGG - Intergenic
938706125 2:133928924-133928946 CTGAAGGCACAGGGTGAAAATGG - Intergenic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939106623 2:137956019-137956041 CAGCGAGCACAGGAGGAGAAAGG + Intergenic
939658564 2:144858771-144858793 CTTGGTGGACAGGGGGAAAATGG - Intergenic
940900682 2:159123877-159123899 CTGGGGGCACGAGGGGAGACTGG - Intronic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
941983505 2:171486692-171486714 GTGGGGACAGAGGGGCAGAAGGG - Intergenic
942942016 2:181630208-181630230 CTGGGGGGGCAGGGGGAGTGGGG - Intronic
942946966 2:181682759-181682781 CTGGGGACGGAGTGGGAGAAAGG + Intergenic
943574008 2:189609533-189609555 ATAGGGTCACAGGGTGAGAAGGG + Intergenic
943701600 2:190993903-190993925 CTGGGGGAAAAGGGTGACAAAGG + Intronic
944342674 2:198621741-198621763 CTGGAGGCTCAGGGGCAGATGGG - Intergenic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
945511735 2:210711685-210711707 CTGGGGCCACTGGGAGAAAATGG - Intergenic
946201387 2:218072753-218072775 CAGAGTGCACAGGGGCAGAATGG - Intronic
946357750 2:219199163-219199185 CTGGGGGGGCAGTGGGAGAGGGG + Intronic
946689918 2:222302109-222302131 CTGGGGGCAGAGGCGCAGAGGGG - Intronic
947581588 2:231322971-231322993 CTGGGTGCACTGGGCGACAAGGG - Intronic
947636704 2:231683957-231683979 CTGGGGGCAAAGGGGCTGACAGG - Intergenic
948023640 2:234758219-234758241 ATGGGGGGACAGGAGGAGATGGG - Intergenic
948062501 2:235052060-235052082 CTGGAAGCAGTGGGGGAGAAGGG + Intronic
948137572 2:235648218-235648240 CTGAGGGCACAGGAGGTGGAGGG - Intronic
948237259 2:236400419-236400441 CTGGCGGCAGAGGGGCAGAGGGG - Intronic
948731131 2:239964371-239964393 CCGGGGGCTCAAGGGGAGATTGG - Intronic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948893061 2:240916399-240916421 CGGGGGGCACCGGGGAAGGAGGG - Intergenic
948933466 2:241147899-241147921 CAGGAGGCACAGCGGGAAAAAGG - Intronic
1169111886 20:3039534-3039556 TTGGGGGCACACTGGGAGAGTGG + Intergenic
1169393075 20:5205915-5205937 CTAGGGGCACAGAGAGGGAAGGG + Intergenic
1170193965 20:13671594-13671616 CTCAGGACACTGGGGGAGAAGGG - Intergenic
1170455188 20:16526167-16526189 CTGGGGACTCAGGAAGAGAACGG - Exonic
1170657052 20:18297876-18297898 CTGGGGGCGCAGTGGCATAATGG - Intronic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174204655 20:48829434-48829456 CTAAGGACACAGGGAGAGAATGG + Intergenic
1174258639 20:49277734-49277756 CTGGGGTCTGAGGGGGAGACGGG + Intronic
1175061881 20:56250985-56251007 CTGGGAGCAAAGGGTGAGACTGG + Intergenic
1175306961 20:57982772-57982794 GTGGGCGCACAGGTGGAGATGGG + Intergenic
1175414249 20:58791230-58791252 CTCGAGGAACAGGGGGAGATGGG - Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176135831 20:63521607-63521629 CTGGAGGAGCGGGGGGAGAAAGG - Intronic
1176303975 21:5113949-5113971 CAAGGAGCTCAGGGGGAGAAAGG + Intergenic
1177107004 21:16969332-16969354 CTGGGGGCACTGGGGGCAGAGGG + Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178601007 21:33994064-33994086 CTGAGGGCACAGGGGCAGACAGG + Intergenic
1179177811 21:39021602-39021624 CTGGGCGCAAAGGGGGAGAGAGG + Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179853055 21:44148001-44148023 CAAGGAGCTCAGGGGGAGAAAGG - Intergenic
1179896495 21:44366330-44366352 CTGGGTGCACAAGGACAGAAGGG + Intronic
1179933985 21:44591059-44591081 CGGGGGGCACAGGGTGAGGTGGG - Intronic
1180080845 21:45486947-45486969 CTGGGGGCCCAGGGGGCCCAGGG - Exonic
1180631433 22:17232841-17232863 CTGGAGCCCCAGGGAGAGAAGGG - Intergenic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181522944 22:23459885-23459907 CTGGGGGCCCAGGGGGCGTCTGG - Intergenic
1181936993 22:26446116-26446138 CTGGAGGCTCAAGGTGAGAAAGG + Intronic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182359538 22:29738442-29738464 CTGTGGGGACAGGGAGACAAAGG + Intronic
1182605157 22:31497050-31497072 CTGCGGGCTCAGTGGGAGTAAGG - Intronic
1183043272 22:35199535-35199557 CTGTGGCAACAGGGAGAGAAAGG - Intergenic
1183413837 22:37671557-37671579 CAGGGGGCAGAGGCGGGGAAAGG - Intergenic
1183522035 22:38301020-38301042 CTGGGGCCACAGAGGTGGAAAGG + Intronic
1183744255 22:39684313-39684335 CTGGAGGCATCCGGGGAGAAGGG - Exonic
1184364557 22:44041778-44041800 CCGGAGGCTGAGGGGGAGAATGG + Intronic
1184877354 22:47284040-47284062 CTGGGGGCACTTGGGGAGACAGG + Intergenic
1185254660 22:49825688-49825710 CTCGGGGCCCAGGGGGATCAGGG + Intronic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949595964 3:5547576-5547598 CTGGGGGTACAGGGATAGAGTGG + Intergenic
949702589 3:6776301-6776323 CAGGGGGTAGAGGGGGAGCAGGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950037632 3:9898629-9898651 CTGGAGTCAGAGGGGGAAAAGGG - Intergenic
950476883 3:13220340-13220362 CTTGGGGCCCAGGAGAAGAATGG + Intergenic
950542067 3:13618696-13618718 CTGGGGGCAGAGGGGGTAGAAGG - Intronic
950920099 3:16685463-16685485 TTGGGGGCAAAAGGGGAGCAGGG - Intergenic
952163821 3:30723949-30723971 CTAGGGCCATAGGGGGAGCATGG + Intergenic
952268355 3:31808227-31808249 TTGGAGGGAAAGGGGGAGAAAGG + Intronic
952325796 3:32319434-32319456 GTGGGGGCATAGGGAGAGAGAGG - Intronic
953221307 3:40974143-40974165 TTGGTGTCACAGGGGAAGAAGGG - Intergenic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953384888 3:42500965-42500987 CTGGGGGCACAGAGGTGGATGGG - Intronic
954301699 3:49703840-49703862 CTGAGGGCACAGCGAGAGCAAGG + Intronic
954412214 3:50375745-50375767 CAGGGGGCGCTGGGGTAGAAGGG + Intronic
954683435 3:52358207-52358229 CTGGGGGCACAGGGAGCGCCTGG - Intronic
954710167 3:52501615-52501637 CTGGGGGCAGAGGGTGGGCAGGG - Intronic
954753538 3:52826945-52826967 CCGGTGGCCCTGGGGGAGAAGGG + Exonic
954916427 3:54151833-54151855 CTGGGGGCAGGGGGAGATAAAGG - Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
955640655 3:61080351-61080373 CTGAGGGCAAAGGGGAGGAAGGG - Intronic
955818334 3:62871394-62871416 ATGGGTGTACAGGGGAAGAAAGG + Intronic
956048513 3:65222259-65222281 CTGCCGGGGCAGGGGGAGAATGG - Intergenic
956305656 3:67821590-67821612 CTGGAGGCAGAGGGGTAGAGGGG - Intergenic
956742938 3:72289174-72289196 CTGGGGGCTCAAGGGGAGATGGG + Intergenic
957208449 3:77229765-77229787 TTGGCAGCACAGGGAGAGAATGG - Intronic
957368587 3:79259565-79259587 GTGGGGGCATAGGGGGAGGTGGG - Intronic
958129532 3:89400306-89400328 CGGGAGGCTGAGGGGGAGAATGG - Intronic
958695110 3:97517738-97517760 GTGGGGGCACCGGTGGGGAAAGG - Intronic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
958998990 3:100939812-100939834 CTGGGAGCACTGTGGGAGACTGG + Intronic
959013001 3:101099987-101100009 CTGGGGGTAGAGGAGGGGAAGGG + Intergenic
960288588 3:115857270-115857292 GTGGGGGCAAAGGGAAAGAAAGG - Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
960887273 3:122409001-122409023 GTGGGGGAGCGGGGGGAGAAAGG - Intronic
960986546 3:123284739-123284761 GTGGGGGAACAGGAGGAGAGAGG + Intronic
960989781 3:123303029-123303051 CTGGGTGCACAGGGGCTGGAAGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961043796 3:123695085-123695107 TTGGGGGCAGAGGGGAGGAAGGG + Intronic
961321672 3:126081351-126081373 GTGGCGGGACAGGGGGAAAAAGG + Intronic
961352935 3:126315553-126315575 CAGGGGGGACAGGAGGAGAGCGG + Intergenic
961511927 3:127408615-127408637 CTGAGGACACAGGGGAAGAGAGG + Intergenic
961642183 3:128371627-128371649 CAGTGGGCACATGGGGAGGAGGG + Intronic
961750014 3:129089187-129089209 CTGGGGTCACATGGTCAGAAGGG - Exonic
961786989 3:129353311-129353333 CTGGGGACACACGGGGACCACGG - Intergenic
961873530 3:130004258-130004280 CTGGGGAGCCCGGGGGAGAAGGG + Intergenic
962131941 3:132688892-132688914 CTGGGGGGAAAAGGGGTGAAAGG + Intronic
962750998 3:138434814-138434836 CTGGGGGCCCCGGGGGCGCAGGG - Exonic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963085716 3:141434393-141434415 CTGGGGGGGCGGGGGGAGTATGG + Intronic
963864341 3:150344228-150344250 TTGGGAACACAGGGGGTGAAGGG - Intergenic
964470237 3:157045457-157045479 CTGAGGGAACACGGTGAGAATGG - Intronic
964710752 3:159668988-159669010 CTGGGAGCACTAGGGGAAAAGGG - Intronic
965637473 3:170798273-170798295 CTGGGGGTTGAGAGGGAGAAGGG + Intronic
966924107 3:184633467-184633489 CTGGGGGCAGAGTCGGGGAAGGG - Intronic
967131173 3:186471966-186471988 CAGGTGGCACATGGGGAGGAGGG - Intergenic
967549106 3:190768556-190768578 CTTGGGGGACAGGGGGAAATGGG - Intergenic
968599584 4:1502669-1502691 CTCGGGGCACAGGCGGTGCATGG - Intergenic
968612510 4:1563641-1563663 GTGGGGGCACTGGAGGAGCAAGG + Intergenic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
968814446 4:2814741-2814763 GTGGGGGCTCAGGGGAAGGAGGG + Intronic
969115515 4:4868521-4868543 GAGGGGACCCAGGGGGAGAAAGG - Intergenic
969217596 4:5734799-5734821 CTGGGGATAGAGGGGGTGAAGGG - Intronic
969391895 4:6896946-6896968 CTGGGGGCACAGGAGATGATTGG - Intergenic
969564931 4:7971897-7971919 CTGGGGGCCCAGGCTGAGCAGGG - Intronic
969687215 4:8682397-8682419 CTGGGTGCCCTGGGGTAGAAGGG - Intergenic
969721481 4:8894930-8894952 CAGGGTGCACAAGGGAAGAACGG - Intergenic
970605707 4:17680018-17680040 CTTGGGGCAAAGGGTGAGAAGGG + Intronic
972720094 4:41687871-41687893 GTGGGAGAACAGGGAGAGAAAGG - Exonic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974801363 4:66823115-66823137 CTTGGGGCAAAGGGTGAGAAGGG - Intergenic
975639454 4:76484827-76484849 GTGGGGGCAGAGGGAGACAAAGG - Intronic
976152219 4:82103954-82103976 CTTGGGGGAAAGGGTGAGAAGGG + Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978591708 4:110330801-110330823 CAGGAGACAAAGGGGGAGAAGGG - Intergenic
979215506 4:118159135-118159157 CAGGGGACAGAGGGGCAGAAGGG + Intronic
980208507 4:129754301-129754323 CTGAGGGCACCTGGGCAGAATGG + Intergenic
980469176 4:133228569-133228591 CTTGGAACACAGGGTGAGAAAGG - Intergenic
981117931 4:141013979-141014001 CTGGGGGCTCAGGGGAGGGAGGG - Intronic
981617309 4:146655232-146655254 CAGGGGGCGCAGGCGGGGAATGG - Intergenic
982046185 4:151448463-151448485 CTGGAGGCCAAGGGGGATAATGG - Intronic
982502492 4:156174188-156174210 CTGTGGTCACATGGGGGGAAGGG + Intergenic
982584728 4:157222276-157222298 CTGGGGGCAGCGGGCGAGAGCGG - Intronic
984743806 4:183193888-183193910 ATGGGGGCGGAGAGGGAGAAAGG + Intronic
985118581 4:186616462-186616484 CTGGGGCCAGAGGGTGAGAAGGG - Intronic
985650030 5:1103111-1103133 CAAGGGGCACAGGATGAGAACGG + Intronic
985851270 5:2390632-2390654 CCTGGGCCACAGGGGGAGGAAGG + Intergenic
986008473 5:3688161-3688183 CTAGGGGGAGAGAGGGAGAAAGG - Intergenic
986993050 5:13576014-13576036 GTGGGGGCACCTGGGGAGAAGGG + Intergenic
987632779 5:20496827-20496849 GTGGAGGCAGAGGGGGATAAAGG + Intronic
988182582 5:27816492-27816514 ATGGGGGTTCAGGGGGGGAAGGG - Intergenic
989011644 5:36877658-36877680 ATGGGGTCACAGGGGGAAGAAGG - Intronic
990171464 5:53054769-53054791 CTGGGGACTCAGGGGGGAAATGG + Intronic
990348321 5:54890770-54890792 CTGGGCTCAGAGGGGGACAAGGG - Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990748619 5:58986671-58986693 CTGGGGGCGCAGGGAGAGAATGG - Intronic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
992166362 5:74055925-74055947 CTGGGGGCATGGGGGAAGGAGGG - Intergenic
992879957 5:81097968-81097990 CTGAGGGCAGAGGGTGAGAGTGG + Intronic
993011345 5:82486781-82486803 CTAGGGGCTCAGAGGTAGAAGGG + Intergenic
993130070 5:83885688-83885710 TTGGGGGCACAGGGAGAGAAAGG - Intergenic
993206163 5:84881910-84881932 CTGGTGGCAAACTGGGAGAAAGG - Intergenic
993691345 5:91004746-91004768 CTGGGGCTTCAGGGGGAGAATGG + Intronic
994397300 5:99235263-99235285 CTGGGGGAGGAGGGGGACAAGGG + Intergenic
994398653 5:99251036-99251058 TTGGGGGCTCGGGGGGAGCAGGG - Intergenic
995608210 5:113880788-113880810 GTGGGGGGCCAGGGGAAGAATGG + Intergenic
996598019 5:125227281-125227303 TTTGGGGCACAGAGGGATAATGG + Intergenic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
997376831 5:133403472-133403494 CTGGGGCCACACGAGGAGCAAGG - Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
998352883 5:141512573-141512595 CCGGGGACCCAGGGGCAGAAGGG - Exonic
998396185 5:141819849-141819871 CTGGGGCCCCAGGAGGAGAGGGG - Intergenic
998877811 5:146618337-146618359 CTGGAGGCTCTAGGGGAGAATGG - Intronic
999331144 5:150674190-150674212 CTGAGGGCCCAGGAGGAGATAGG - Intronic
999486557 5:152002880-152002902 CTGGGGGTAGAGGGAGGGAAGGG - Intergenic
999957422 5:156717857-156717879 CAGGAGGCACAGGGAGTGAAGGG - Intronic
1001015640 5:168138616-168138638 CAGGGAGCACAGGGAGAGAGAGG + Intronic
1001321617 5:170687018-170687040 CAGGGAACTCAGGGGGAGAATGG - Intronic
1001706034 5:173741733-173741755 ATAGGGGGACAGGGGGAGAGGGG + Intergenic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1001883730 5:175269762-175269784 CTGGGGGAAGGGGGAGAGAAAGG + Intergenic
1001929482 5:175662592-175662614 GTGGGGGCAGAGGGGAAGCAGGG - Intronic
1002184381 5:177447293-177447315 CCGGGGGTGCAGGGGGAGAGGGG + Intronic
1002281708 5:178134061-178134083 CTGGGCACTGAGGGGGAGAAAGG + Intronic
1002438894 5:179253761-179253783 CTGAGGCCAAAGGGTGAGAAGGG - Intronic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003367941 6:5494799-5494821 CTAGGGGAAAAGGGGGAGAGAGG - Intronic
1003673935 6:8185459-8185481 GTGGGGGCTGAGGGGAAGAATGG - Intergenic
1004167847 6:13272590-13272612 CTGGGGCCACTGGAGGAGATGGG + Intronic
1004525579 6:16404416-16404438 CTGGGGGCTCTGGGAGGGAAAGG - Intronic
1004729183 6:18341116-18341138 GTAGTGGCACAGGGGGAGAAAGG - Intergenic
1005840531 6:29742250-29742272 CTGGGGAAAGAGGGAGAGAAAGG - Intergenic
1006091105 6:31629607-31629629 ATGGGGGCACTGGGGTAGGAGGG - Exonic
1006296521 6:33172351-33172373 CTGGGGCCCCAGGGGGACCAGGG + Exonic
1006316912 6:33296806-33296828 CTAGGTGCAGAGTGGGAGAAAGG - Intronic
1006380727 6:33695609-33695631 CTGGGCCCACAGGGGAAGACGGG + Intronic
1006383196 6:33712916-33712938 CTGGGGGGAGAGGGGGAAATGGG - Intergenic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1007466913 6:42058947-42058969 TGGGGGGCAGAGGGGGAGACTGG + Intronic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1008463682 6:51805758-51805780 CTGGCTGCAGTGGGGGAGAATGG + Intronic
1009180532 6:60512461-60512483 CTGGGAGCTCAGAGGGATAAGGG - Intergenic
1013225759 6:108118523-108118545 CAGGGGGCGCAGGGGGCGCAGGG + Intronic
1014251081 6:119116175-119116197 GTGGGGGCAGAAGGGGAAAAGGG + Intronic
1015227010 6:130869478-130869500 CTGGGAGGACAGGAGAAGAAAGG + Intronic
1015636973 6:135286595-135286617 CTGGGGGCACAGGAGGTGTAGGG + Intronic
1016213947 6:141572717-141572739 CTCGGGGGAAAGGGGGAGAGCGG + Intergenic
1016400762 6:143677909-143677931 CAGGGGTCACGGGGGAAGAAGGG - Intronic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016923271 6:149317233-149317255 TGGGGGGCCCAGGCGGAGAAAGG + Intronic
1018085057 6:160294318-160294340 CTGGTTGCAGATGGGGAGAAAGG - Intergenic
1019035022 6:169047448-169047470 CTGGGGGCTCAGGGTGTGATGGG + Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019352035 7:558906-558928 CTGGGGGCAGACGGGGAGACAGG + Intronic
1019479543 7:1260199-1260221 CTGGGGGCAGGGGGAGAGAGAGG - Intergenic
1019529978 7:1498599-1498621 GTGGGGGCACAGGCGGAGTGGGG - Intronic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1019906998 7:4072464-4072486 CTGGGGGCACAGGGTGATGCTGG - Intronic
1021669667 7:23022675-23022697 CTGGGGGCAGAGGGCAGGAATGG + Intergenic
1022178482 7:27895262-27895284 GTGGGGTCACGGGGGGAGTAAGG + Exonic
1022206043 7:28164736-28164758 ATGGGGGCAGGGGAGGAGAATGG - Intronic
1022236516 7:28467005-28467027 CTGGAGGGACAGGGGGCCAAGGG + Intronic
1022532263 7:31074443-31074465 CGGGTGGCACAAGGGGAGAAGGG - Intronic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023838831 7:44084179-44084201 CTGCTGGCACAAGGGGAGGATGG - Intergenic
1023872910 7:44272345-44272367 CTGGGTGCCCAGGAGGAGAGGGG - Intronic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1025712743 7:63927317-63927339 CTGGCGGCACTGGGGGAGCAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1028666499 7:93349457-93349479 CTGGGGGCATTGTGGAAGAAAGG + Intronic
1028985860 7:97007470-97007492 CTGGGAGCACACGGGCAGAGTGG + Intronic
1029253118 7:99250973-99250995 CTGGGAACCCAGGAGGAGAATGG - Intergenic
1029270653 7:99374977-99374999 GTGGGGGCACATGGAGAGGAGGG + Intronic
1029351408 7:100015685-100015707 CTGGGGGCGCTGGGCGAGAAAGG - Exonic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1029706226 7:102277796-102277818 GTGGGGCCACAGTGGGGGAAGGG + Intronic
1029893808 7:103960021-103960043 GTGGGGGCAGAGGGCAAGAATGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1032185372 7:129720601-129720623 ATGTGGGCGCAGGGTGAGAAGGG + Intronic
1032389841 7:131548809-131548831 CTGGGGGCATATGGGCAGGAAGG - Intronic
1033602870 7:142901063-142901085 ATGGAGGCAGAGGGGTAGAAAGG + Intergenic
1033789524 7:144774960-144774982 ATGGGGGCGGTGGGGGAGAAAGG + Intronic
1033814677 7:145057437-145057459 CTGGAGGCTCTGGGGGAGGATGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034347520 7:150396668-150396690 CTGGGGGGACAGGAGGAGTCTGG + Exonic
1034422412 7:150996580-150996602 CTGGGGCCTCAGTGGGACAAGGG - Intronic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1034534919 7:151720691-151720713 ATGGGGACAGAGGGGGATAAAGG + Intronic
1035058315 7:156051443-156051465 CTGGGGGTTCAGGGGCAGAGTGG - Intergenic
1035087031 7:156269092-156269114 CTGGGGGCAGATGGGGAGGAGGG + Intergenic
1035221025 7:157406648-157406670 CTGGAGTGACTGGGGGAGAAAGG - Intronic
1036442041 8:8789937-8789959 CTGGGGGCAGGAGGGGAGAGGGG - Intronic
1037096225 8:14990837-14990859 CTTGAGGTACAGGGAGAGAAAGG + Intronic
1037731010 8:21524088-21524110 CAGAGAGCACAGGAGGAGAATGG - Intergenic
1037989545 8:23311149-23311171 CTGGAGGGGGAGGGGGAGAAGGG - Intronic
1038031096 8:23641182-23641204 GTGTGGGGACAGGGGTAGAAAGG - Intergenic
1038444844 8:27596219-27596241 CTTGTGGCAAAGGGGGAGCAGGG - Intergenic
1038790959 8:30667920-30667942 CTGTGGGCTCTGGGGGATAAGGG - Intergenic
1039395548 8:37222388-37222410 CTGGGCCCACAGGGGGAACAAGG - Intergenic
1039431136 8:37526047-37526069 TTGGGGACTCAGGGGGAAAAAGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039475130 8:37835616-37835638 CTGGGGGCACCGGGGGAGCCAGG - Exonic
1039547562 8:38420914-38420936 TTGGGAGCACATGGGGAGCACGG + Intronic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1045314056 8:101027934-101027956 CTGGGTGCAGATGGGGAGAGAGG - Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047874792 8:129123847-129123869 CTGGGGGTACAAGGGTAGACAGG + Intergenic
1047928122 8:129701019-129701041 TCGGGGGCAAAGAGGGAGAAGGG - Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048876813 8:138843134-138843156 CTATGTGCACAGTGGGAGAAAGG - Intronic
1048988805 8:139749555-139749577 CTGGGGGTACAGGGTGAGAGGGG - Intronic
1049214569 8:141401872-141401894 CTGGGGCCACAGCGGGGGAGGGG - Intronic
1049233296 8:141495284-141495306 CAGGGGGCAGAGGGGGAGGGTGG - Intergenic
1049302631 8:141879707-141879729 CAGGAGGGACAGGAGGAGAAGGG - Intergenic
1049302692 8:141879972-141879994 CTGGGAGCACAGGTGGAGAGGGG - Intergenic
1049443749 8:142620663-142620685 CTGGGTGCACATGGGGAGACAGG + Intergenic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049446113 8:142632389-142632411 CTGGGGCCACCAGGGGAGAGGGG - Intergenic
1049513406 8:143041191-143041213 CTGGGAGCACTGCGGGAGACTGG + Intronic
1049617281 8:143581155-143581177 CTGGGGGGGCAAGGGGAGCACGG + Intronic
1049621664 8:143601002-143601024 CTGGGGGCAGATGGGGACGAGGG - Exonic
1049707048 8:144047823-144047845 CTGTGGCCACAGGGTGAGACAGG + Intergenic
1050409176 9:5343728-5343750 CGGGGGGGAAAGGGTGAGAAGGG + Intergenic
1050530111 9:6581261-6581283 TTGGGGGCACTGAGGGAGACTGG - Intronic
1050668441 9:7968170-7968192 CAGGAGGCAGAGGGAGAGAAAGG - Intergenic
1051131458 9:13865583-13865605 CAGGAGGCTGAGGGGGAGAATGG + Intergenic
1051868771 9:21713051-21713073 GTAGGGGCAGAGGGGGAGAGAGG - Intergenic
1053152970 9:35754569-35754591 GTGGTGGCAGTGGGGGAGAAAGG - Exonic
1054974092 9:71121821-71121843 GTGAGGACACAGGGAGAGAAGGG + Intronic
1056456710 9:86767260-86767282 CTTGGGGCAAAGTGGCAGAAGGG + Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059445783 9:114337026-114337048 CTGGGGGCCCAGAGGCAGATGGG - Exonic
1059587293 9:115619898-115619920 CTGGAGGCCCAGGAGGAAAAGGG - Intergenic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1059754163 9:117276689-117276711 CTGAGGGCACAGAGAGACAAGGG + Intronic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1060490907 9:124083457-124083479 GTGGGTGCACAGGAGGAGACAGG - Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060678066 9:125534876-125534898 CTGGGTGCACATGGGAAGCAGGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061004628 9:127921574-127921596 ATGGAGGCTCAGGGGGTGAAGGG - Exonic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061096055 9:128457138-128457160 CTGGGGGCAGAGGGGAGGAAGGG - Intronic
1061153421 9:128842612-128842634 GTGGAGGCACTGGGGGAGGAAGG - Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061404334 9:130385225-130385247 CTGGAGCCACAGGGGCTGAACGG + Intronic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061430415 9:130527203-130527225 CTGGGGGCCCATGGGGGCAAAGG - Intergenic
1061537754 9:131260049-131260071 CTGGGGGTGGAGGGAGAGAAGGG + Exonic
1061538771 9:131266129-131266151 GTGGAGGCAGAGGAGGAGAAGGG - Intronic
1061563448 9:131421581-131421603 CTGGGGGCAGTGAGAGAGAAAGG - Intronic
1061706526 9:132457308-132457330 GTGGGGGGGCGGGGGGAGAAAGG + Intronic
1062118133 9:134820149-134820171 CCGGGTGAACAGGGTGAGAAGGG + Exonic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062255761 9:135619944-135619966 ATGGGGGAGAAGGGGGAGAAGGG - Intergenic
1062255864 9:135620201-135620223 TAGGGGGAAAAGGGGGAGAAGGG - Intergenic
1062271633 9:135712548-135712570 TTTTGGGCACAGGGGGAGAGGGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062376745 9:136265266-136265288 CTGGGGGCACATGTGGAGGGGGG - Intergenic
1062615427 9:137393952-137393974 TTGTGGGCAGAGGGTGAGAAGGG - Intronic
1185448591 X:271334-271356 CCTGGGGCACAGCGGGAGGAAGG + Intergenic
1185712525 X:2315337-2315359 CGTGGGGTACAGGGTGAGAAAGG + Intronic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1187716030 X:22103459-22103481 TTGGGGACTCAGGGGGAGAGTGG - Intronic
1188980661 X:36724221-36724243 CTGGTGGCACATGGAGAGAGGGG + Intergenic
1189429345 X:40933152-40933174 CTGAAGGGAAAGGGGGAGAAGGG - Intergenic
1190327791 X:49217507-49217529 CTGGGGGCTCAGGGTGGGAATGG + Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1190960074 X:55237555-55237577 CTGGGGGCTCGGAGGGTGAAAGG - Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192574420 X:72231399-72231421 CTGGGGGGATAGGGGTAGATGGG + Intronic
1193659373 X:84238338-84238360 CTGGGGACTCAGGGGAAGGATGG + Intergenic
1194013890 X:88595868-88595890 CTGGAGGGATATGGGGAGAACGG + Intergenic
1195221952 X:102753123-102753145 TTAGGGGCACAGGGAGAGAGGGG - Exonic
1196037282 X:111159607-111159629 CAGGGGGCACAGGGAGAAATGGG - Intronic
1196465503 X:115968549-115968571 CGGGGCGAACAGGAGGAGAAGGG - Intergenic
1196551543 X:117032601-117032623 CTGGAGGGACAGTGTGAGAAAGG - Intergenic
1197024097 X:121726724-121726746 CTTGGGGCACAGTAGCAGAATGG - Intergenic
1199874640 X:151920601-151920623 ATAGGGGCACAGGTGGGGAATGG - Intronic
1200163719 X:154022145-154022167 CTTGGGGCACAGGGAGAGGCCGG - Intronic
1201235710 Y:11908902-11908924 CTGTGGGCCCTGGAGGAGAAAGG + Intergenic