ID: 962834857

View in Genome Browser
Species Human (GRCh38)
Location 3:139181135-139181157
Sequence CTGGAGTCCTTGGGAAGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962834851_962834857 8 Left 962834851 3:139181104-139181126 CCAGCTATTGGGTCTGCAGGCAG 0: 1
1: 0
2: 1
3: 16
4: 132
Right 962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962834857 Original CRISPR CTGGAGTCCTTGGGAAGTAT GGG Intronic
900160195 1:1219685-1219707 CTTGGGTCCTTGGGATGTGTGGG - Intronic
902782927 1:18716233-18716255 TTGGAGGCCTTTGGAAGGATGGG + Intronic
905792186 1:40795786-40795808 CTGGAGACCTGGGGAACTCTAGG + Intronic
905951954 1:41959355-41959377 TTGGAGTCCTTGGATAGTAGTGG - Intronic
906684134 1:47752146-47752168 CCTGAGTCCCTGTGAAGTATGGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907934817 1:59032781-59032803 CTTGAGGCCTGGGGAAATATGGG - Intergenic
912445940 1:109736738-109736760 CTGGAGTCCCTGTGAAGACTGGG - Exonic
916074732 1:161193787-161193809 CTGGGGTCCTTGGGGACCATGGG - Exonic
916444762 1:164862022-164862044 CTGGAGGCCTTGGAATGTTTGGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
919361468 1:196601073-196601095 CAGGAGGCATTTGGAAGTATGGG - Intronic
920090580 1:203450158-203450180 CTGGAGGCTTTGGGAAGCATGGG + Intergenic
1063285730 10:4685743-4685765 CTGGACTACTTTGGAAGTGTTGG + Intergenic
1067513160 10:46911874-46911896 CTTGAGTCATTGGGAAGTTCTGG - Intronic
1067649093 10:48139968-48139990 CTTGAGTCATTGGGAAGTTCTGG + Intergenic
1068793625 10:61053769-61053791 TTGGAGTCCTTTGTAAGTTTGGG + Intergenic
1069659514 10:70114397-70114419 CTGAAGGCCTCGGGAAGGATCGG - Intronic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1070536021 10:77377731-77377753 CTGGAGATCCTGGGAAGTAGAGG + Intronic
1070725302 10:78783648-78783670 CTGGAGGCAGTGGGAAGTAGAGG - Intergenic
1073575111 10:104616235-104616257 CTGTGGCCCTTGAGAAGTATTGG - Intergenic
1074840004 10:117341507-117341529 TTGGTATCCTTGGGAAGTACTGG - Intronic
1075567320 10:123514063-123514085 CTGGAGTCCTGGGGAAGGGGAGG + Intergenic
1077235513 11:1480269-1480291 CTGGAGACCCTGAGAAGTCTTGG - Intronic
1078171666 11:8933071-8933093 CAGGAGGCCTTGGGAGGTAGGGG + Intergenic
1081601148 11:44495281-44495303 CTGTAGACCTTGGGTGGTATTGG - Intergenic
1084649305 11:70479383-70479405 CTGGAGGCCTTGGGAAGGGGAGG + Intronic
1085587502 11:77724253-77724275 CTAGAGTCCTTGGGCACTACTGG + Intronic
1087334370 11:96824734-96824756 CTGGGGGCCTTGGGGAGTATGGG + Intergenic
1090005265 11:122996810-122996832 CTGAAGTACTTGTAAAGTATTGG + Intergenic
1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG + Intronic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094368253 12:29707035-29707057 CTGGAGCCCTTGGGTCCTATGGG + Intronic
1094595541 12:31862852-31862874 CCGGAGTCCTTGGGATATACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098385360 12:69912917-69912939 CTGGAATCTTTGGGAACTGTTGG - Intronic
1098849416 12:75577631-75577653 CTGCAGGCCTTGGGAAGCTTAGG - Intergenic
1100897244 12:99197357-99197379 CTGGAGTTCTTGGGAGGGAATGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102390825 12:112547285-112547307 ATGCAGTCCTTGGGCAGGATGGG + Intergenic
1102731420 12:115114259-115114281 CTGCAGTCCATGGGAATCATTGG - Intergenic
1103176719 12:118870569-118870591 TTGGAGTGTTTGGGAAGTACAGG + Intergenic
1118911127 14:70063006-70063028 TTGGAGGCCATGGGATGTATGGG + Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1125609254 15:40959765-40959787 CAGGAGTCGGTGGGAAGGATCGG + Intergenic
1125898043 15:43319108-43319130 CTGGCTTCCTGGGGAAGGATAGG - Intergenic
1127139460 15:55960123-55960145 CTGCAGTCCTTTGGGGGTATGGG - Intronic
1127209799 15:56761813-56761835 CTGGAGACCTAGGGAAGGGTTGG - Intronic
1127431511 15:58914517-58914539 GTGGAGTCCTTGGGGAGCAGGGG + Intronic
1131367531 15:91853335-91853357 CCGGAGTCCTTGCGGAGTAAGGG - Intergenic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1132679877 16:1135300-1135322 ATGGAGTCCTTGGGACCTAGAGG - Intergenic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1135541484 16:23333341-23333363 CTAGAGACCTTGGGGAGTATGGG + Intronic
1139567985 16:67791607-67791629 CTGGAGCCCCTGGGAGGTCTAGG - Intronic
1142109271 16:88322654-88322676 CTGGAGTCCGTGGGATGGAGGGG - Intergenic
1146124104 17:30218461-30218483 CTGGAGTCCTTGGAATGGAATGG - Intronic
1147332439 17:39706796-39706818 CTTGCGTGCTTGGGAAGTAGAGG - Intronic
1148019020 17:44541589-44541611 CTGGGGTCCTTGAGAAGCAGAGG + Intergenic
1149332265 17:55596282-55596304 CTGGAATCCTTGTGCATTATTGG - Intergenic
1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG + Intronic
1149993046 17:61393393-61393415 CTGGGGTCTCTGGGAAGTGTGGG - Intergenic
1156352688 18:36314651-36314673 CTGGAGGCCTTGGCAACTTTAGG - Intronic
1160596722 18:79980628-79980650 GTGGAGTCTTTGTGAAGTGTGGG - Intronic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1165071740 19:33259777-33259799 CTGGAGTTCTTGGGAGGTGGAGG - Intergenic
925006140 2:444584-444606 CTGAAGGCCCTGAGAAGTATTGG + Intergenic
926591849 2:14749031-14749053 CTAGAGGCCATGGGAAGTGTGGG + Intergenic
927393256 2:22620250-22620272 TTGGAGTTCTTGGGGAGTTTAGG + Intergenic
927510184 2:23639469-23639491 CTGGAGTCCTTGAGTAGCAGAGG - Intronic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
928729311 2:34212310-34212332 ATGTAGTCCTTGGAAAGTAAAGG + Intergenic
929019625 2:37538691-37538713 CTGAAGTCCTTGAGAAGAAGGGG + Intergenic
929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG + Intronic
931282757 2:60808377-60808399 CGGTAGACCATGGGAAGTATTGG + Intergenic
932871982 2:75409986-75410008 CTGGAGTCTTTGGGGAGGTTTGG - Intergenic
937112646 2:119378449-119378471 GTGGAGTCCTTGGAAAGGACTGG + Intergenic
938315130 2:130319605-130319627 CTGGAGTCCTGAGGAAGGAGAGG - Intergenic
948918211 2:241048946-241048968 CTCGAGTCCTTGTCAAGGATGGG - Intronic
1171034016 20:21702392-21702414 CTGGAGTCCTTGAAATGCATGGG + Intergenic
1175808022 20:61841509-61841531 CTGGTGGCCTTGGGCAGTAGAGG + Intronic
1176018071 20:62947589-62947611 CTGGAATCTTTGTGAAGCATAGG + Exonic
1176113463 20:63421136-63421158 CAGGAGACCTTGGGAGGTTTGGG - Intronic
1176124183 20:63468128-63468150 CTGGACCCCTTGGGAGGTCTCGG - Intronic
1180909422 22:19438611-19438633 TTGGAATCCTTGGGCACTATTGG - Intronic
1182934816 22:34210875-34210897 CTGGAGACCTTGGGAAGTGGAGG - Intergenic
1184506673 22:44907917-44907939 CTGGAATCTCTGGGAAGTACAGG + Intronic
949507806 3:4743266-4743288 CAGGAGTCCTTGAGGATTATTGG + Intronic
949692656 3:6657845-6657867 CTGGACTCCTTTGGATTTATAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951210261 3:19966917-19966939 CTGGACTACTTGGGAGGTACAGG - Intronic
951405448 3:22291045-22291067 ATGGAGCCTTTGGGAAGTAATGG - Intronic
952042117 3:29273534-29273556 CTGGAGACCTGGGGAAGAGTTGG + Intergenic
952314291 3:32218998-32219020 ATGGTGCCCTTGGGAAGTTTAGG - Intergenic
953474786 3:43195913-43195935 CTGGAGTGCCTGGCAAGGATTGG + Intergenic
954711416 3:52506803-52506825 CTGCAGTGCTTGGGCAGGATGGG - Exonic
954909132 3:54088174-54088196 CTGTCGTGCTTGGGAAGAATGGG - Intergenic
955029773 3:55204903-55204925 CAGGAGTCCTGTGGAAGGATAGG - Intergenic
957578014 3:82034046-82034068 CTCTAGCCCTTGGGAAATATGGG + Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966947859 3:184789934-184789956 CTGGATGCCATGGGAAGTCTTGG + Intergenic
969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG + Intergenic
972332059 4:38073230-38073252 CTGGAGCCCTTGGGCACTGTTGG - Intronic
972687094 4:41361573-41361595 CTGCAGTCCTTGGGATGGAGAGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
985213792 4:187626951-187626973 CTGGAGTCCAGGCAAAGTATTGG + Intergenic
985280308 4:188280000-188280022 GTAGAGTACTTGGGAAGTCTGGG + Intergenic
987867515 5:23564399-23564421 AAGGAGTCCTTGGGAGGTGTTGG + Intergenic
994649640 5:102510473-102510495 CTAGAGTCCTTGGGGAGTCCTGG - Intergenic
997693727 5:135845282-135845304 CTAGTGTCCTTAGGAAGGATGGG - Intronic
999967496 5:156824998-156825020 CAGCAGTCCTTGGGAATTTTAGG - Intergenic
1006145241 6:31954990-31955012 CCTGAGTCCTTGGGAGGTTTGGG - Intronic
1011185750 6:84673683-84673705 CTTGAGGCCTTGGGAAGTCATGG + Intergenic
1016311717 6:142740344-142740366 ATGGAGATCTTGGAAAGTATGGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG + Intergenic
1019507412 7:1399273-1399295 CTGGAGACCTGGGGAAGCAGAGG - Intergenic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1021068642 7:16209351-16209373 CTTGAATCCCTGGGAAGTAGAGG - Intronic
1021154112 7:17188304-17188326 CAGTAGTCCTTCGTAAGTATTGG - Intergenic
1022982210 7:35614624-35614646 CTGGAGACCTGGTGTAGTATAGG - Intergenic
1023737170 7:43245482-43245504 CTAGTGTCCTTGGGAAGTTAGGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1031814597 7:126417829-126417851 CTGGAACCCTTGGGAGGTATAGG - Intergenic
1034058003 7:148056809-148056831 TTGGCGTCCTTGAGAAGTAATGG + Intronic
1035002946 7:155630220-155630242 CTGGAGCCGTAGGGAAGCATAGG - Intronic
1036556885 8:9867928-9867950 CTCGAGTAGCTGGGAAGTATAGG + Intergenic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1044918271 8:97138829-97138851 GTGGAGACCTTGGAAATTATAGG - Intronic
1045569326 8:103353220-103353242 CTGGAGTCTGTTGGAAGTTTTGG - Intergenic
1049996665 9:1041736-1041758 CTGGAGCACTTGTGAAGTTTTGG - Intergenic
1052252149 9:26410995-26411017 CCTGAGTCCCTGGGAAGTTTGGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053311448 9:37023383-37023405 CTGGAGTCCATAGGAAGTACAGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056288323 9:85114094-85114116 ATGCAGTCCATGGGAAATATGGG - Intergenic
1059189796 9:112314153-112314175 TTGGGGTCCTTGGGAAGTACTGG + Intronic
1060036241 9:120258280-120258302 CTGGGGTCCCTGGGGATTATGGG + Intergenic
1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG + Intronic
1187608995 X:20919991-20920013 CTTCAGTGCTTGGGAAGTAAGGG - Intergenic
1188317681 X:28694720-28694742 CTGGATTGGTTGAGAAGTATGGG - Intronic
1197484009 X:127024494-127024516 CTGGTATCCTTGAGAAGAATGGG - Intergenic
1198767815 X:140096114-140096136 CTGGAATCATTGGGATCTATAGG + Intergenic