ID: 962835125

View in Genome Browser
Species Human (GRCh38)
Location 3:139183128-139183150
Sequence AATTCTGGGGCTCCACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962835119_962835125 6 Left 962835119 3:139183099-139183121 CCACTTCTTATTAATCAAAGATG 0: 1
1: 0
2: 3
3: 15
4: 268
Right 962835125 3:139183128-139183150 AATTCTGGGGCTCCACATGAGGG 0: 1
1: 0
2: 1
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962835125 Original CRISPR AATTCTGGGGCTCCACATGA GGG Intronic
901441552 1:9281341-9281363 AATTCAAGGCCCCCACATGATGG - Intergenic
904792345 1:33032874-33032896 ATTTCTGGGGCTGGACATGATGG + Intronic
907468112 1:54652990-54653012 AATCCCGGGGCCCCACAGGAGGG - Exonic
912393476 1:109321244-109321266 AACTCTGGGGGTCTAGATGAGGG + Intronic
922899520 1:229125271-229125293 AATTCTGCTGCTCAAGATGACGG - Intergenic
1063468716 10:6266830-6266852 AAACCTGGGGCCCCGCATGATGG + Intergenic
1066084748 10:31965261-31965283 AATTCTTGGGCTGGGCATGATGG + Intergenic
1068969148 10:62945062-62945084 AATTCTGGGGGTCCAACTCAAGG - Intergenic
1073197606 10:101705979-101706001 AAGTCTTGGGCTCCACATGGTGG + Intergenic
1075589329 10:123679987-123680009 AGTTCTGGAGCTCCATATGGAGG + Intronic
1077433192 11:2526183-2526205 AATACTGGGGCACGACATGGAGG + Intronic
1078668715 11:13346610-13346632 ATCTCAGGGGCTCCACAGGAAGG - Intronic
1078899715 11:15630224-15630246 AATTATGGGGCTCCTCAGGCAGG - Intergenic
1080398712 11:31914349-31914371 TATTCTGGGCCTCTACAGGATGG - Intronic
1083145164 11:60752703-60752725 AATGCTGTGTCTTCACATGATGG + Intergenic
1083182992 11:61000113-61000135 CATTCTGGGGCTCCAGTGGATGG + Intronic
1085263084 11:75219488-75219510 ATTTCTGGGGCTCCAATTGTTGG + Intergenic
1087410383 11:97784016-97784038 AAGTCAGGGACCCCACATGAAGG + Intergenic
1087927265 11:103933485-103933507 AATTTTGTGACTCCACATGTGGG + Intronic
1088832701 11:113551024-113551046 AATTCTGGGGCCAGACATGGTGG - Intergenic
1089478217 11:118783474-118783496 AATTCTGGGGCTGGATATGATGG - Intronic
1090421195 11:126576170-126576192 AATTCTGGGGGCCAAGATGAGGG + Intronic
1092869419 12:12793143-12793165 AATTCTGGGGCACCTCATGCTGG - Intronic
1094775437 12:33721696-33721718 AATTCTGAGGTTTCCCATGAAGG + Intergenic
1097852499 12:64426663-64426685 AATTCAGGGGGTACACATGGAGG - Intronic
1104545815 12:129711952-129711974 AACTCTGGGGCTCAACATTCAGG - Intronic
1105679119 13:22707178-22707200 AACTCTGAGGCTCCACACCAAGG + Intergenic
1107657272 13:42604512-42604534 AATTCTTGGTCTTCTCATGATGG + Intronic
1109326454 13:60873098-60873120 AATTCTGGGACTCCAGAGGAGGG + Intergenic
1109532567 13:63669786-63669808 ACTTCTGGGGATCCACCTAAAGG + Intergenic
1112844209 13:103617973-103617995 AATTCTGGGGAGTCACATGAGGG - Intergenic
1114151758 14:20048530-20048552 AACTCTGCAGCTCCACCTGAGGG - Intergenic
1115032567 14:28814613-28814635 AATTCTGGGGGTACATATGCAGG - Intergenic
1115439428 14:33415116-33415138 AATTCTGGGGCTCTGCATGGAGG - Intronic
1117338807 14:54776721-54776743 AACTCTGGGGCTCCACATGCTGG - Intronic
1119688796 14:76654425-76654447 AACTCTGGGGCTACACGTCAGGG + Intergenic
1124620497 15:31271312-31271334 ATATCTGGGCCCCCACATGATGG + Intergenic
1125412276 15:39417885-39417907 CATTCTGGCTCTCCACAAGATGG - Intergenic
1128032695 15:64495656-64495678 ACTTCTGGGCCTCCACCTGGAGG - Intronic
1128107256 15:65054223-65054245 AACTCTGGGGCTCCTTATGCTGG + Exonic
1132183299 15:99779224-99779246 AATTAAGGAGCTCGACATGAAGG - Intergenic
1132435135 15:101794257-101794279 AATTCAGGAGCTCGACATGAAGG + Intergenic
1135748307 16:25036321-25036343 AACTCTGGGGCACAGCATGATGG - Intergenic
1140082624 16:71763084-71763106 AATGCTGGAGCTGGACATGATGG + Intronic
1142665520 17:1461121-1461143 AACTCTGGGGCACCATGTGAGGG + Intronic
1143431524 17:6891078-6891100 ATTCCTGTGGCTCCATATGAAGG + Intronic
1144797822 17:17904513-17904535 GGGTCTGGGGCTCCTCATGAGGG + Intronic
1145268872 17:21393623-21393645 AGTCCTGGGGCTCCACCTCATGG + Intronic
1146125132 17:30225342-30225364 GAGTCTGGGGCTCCACAGGCAGG - Intronic
1148839854 17:50488059-50488081 GATTCTGGGGCTCCACCTCCGGG - Intergenic
1150455036 17:65300516-65300538 AACTCTGTGTCTCCACATTAGGG - Intergenic
1155047276 18:22113902-22113924 AAGTCTGTAGCTCCAAATGATGG + Intergenic
1155225430 18:23725553-23725575 AGGTCTGGGGCTCCCCATAAGGG + Intronic
1167821891 19:51935907-51935929 ACTTCTGGGGCCCCAAATAAAGG + Intronic
925638016 2:5960547-5960569 TATTCTGGCTCTCCACATGAAGG + Intergenic
925916991 2:8614073-8614095 AAGTCTCGGGCTCCCCATGCGGG - Intergenic
926207062 2:10841339-10841361 AGGTCTGGGGCTCCACTCGAGGG - Intergenic
928253497 2:29701976-29701998 ATGTCTGTGGCTCTACATGAGGG - Intronic
928425963 2:31177923-31177945 ATATCTGAGGCTCCACATGCAGG + Intronic
931652669 2:64482656-64482678 TATCCTGGGCCTCCACATCAAGG - Intergenic
932879513 2:75488083-75488105 AATTCTGAGGCTCTAGATGATGG - Intronic
933577351 2:84084460-84084482 AATTCTGGGGATCCACAATTTGG - Intergenic
936095888 2:109529760-109529782 AACCCTGGGGCTCAACCTGAGGG + Intergenic
937911444 2:127077587-127077609 AATCCCAGAGCTCCACATGACGG + Intronic
938056087 2:128215738-128215760 CATTCTGGGGCTGGGCATGATGG + Intergenic
942377710 2:175354271-175354293 AAAACTGTGGCTCCAGATGAGGG - Intergenic
945654437 2:212605822-212605844 AATTCAGGGGCTACAGATGAAGG - Intergenic
946617870 2:221529231-221529253 AATTCCAGGTCTCCACAGGAAGG + Intronic
947637896 2:231689259-231689281 GATCCTGGGGCTCCAGTTGAGGG - Intergenic
1168956112 20:1835647-1835669 ATTTCTGGGTCTCCTCATGTGGG - Intergenic
1170576956 20:17671511-17671533 AAGTCATGGGATCCACATGAGGG + Intronic
1170930528 20:20766399-20766421 AATTCTGGTAATCCACTTGATGG - Intergenic
1172028390 20:31965246-31965268 AATTCTGAGGCTGGACATGGTGG - Intergenic
1175169634 20:57070922-57070944 AATCCTGGGGTTCCATATTACGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1181414641 22:22750554-22750576 AATTCTTAGGCTCCAAATCAAGG + Intronic
1182043304 22:27255043-27255065 AATCTTGGAGCTCCCCATGAAGG + Intergenic
1182346638 22:29671108-29671130 ATTTCTGGGGCTCTATCTGAGGG + Intronic
949101906 3:155723-155745 AATTTTGGGGCACCACGTCAAGG + Intergenic
951813438 3:26726989-26727011 TATTTTGGGCCTCCACCTGATGG - Intergenic
953082107 3:39630514-39630536 AATTTTGGGGCTTCTCATAAGGG - Intergenic
953827190 3:46263839-46263861 AATACTGAGGCCCCACATGTTGG - Intronic
954443639 3:50535119-50535141 AAAGCTGGGGCTCCAGCTGAGGG - Intergenic
957883362 3:86250492-86250514 AATTCTGATGCTCCACAGAATGG + Intergenic
962835125 3:139183128-139183150 AATTCTGGGGCTCCACATGAGGG + Intronic
963300348 3:143590702-143590724 AATCCTGTGGCTACACCTGAAGG + Intronic
964482517 3:157156275-157156297 AATTCTGTGGCTCTACAAGGTGG - Intronic
964497641 3:157310665-157310687 AATTCTGAGCCACCACATGGAGG - Intronic
968840371 4:3000147-3000169 ACTTCTGGGGCTTTACATTAAGG - Intronic
969504154 4:7573830-7573852 ACTTCAGGGGCTCCCCATGCAGG + Intronic
976046021 4:80949042-80949064 ATTTCTGGGACTGCACAAGAAGG - Intronic
983991008 4:174119635-174119657 GATTCAGGGGCTACACATGCAGG - Intergenic
986754897 5:10826440-10826462 CAATAGGGGGCTCCACATGAGGG + Intergenic
986916196 5:12623868-12623890 AATTCTGGCTCCCCACATGTGGG + Intergenic
988769275 5:34415083-34415105 AATTTTGGGGCTTCACATTTTGG + Intergenic
989506881 5:42236446-42236468 AATGCTGTGTCTTCACATGATGG + Intergenic
992575546 5:78106794-78106816 AATTCTGGGGCTTCAGATCTGGG + Intronic
992638858 5:78751423-78751445 CATTCTGAGGCTCCTCATGAAGG - Intronic
995261602 5:110110583-110110605 TATTCTCAGGCTCCACATGGTGG + Intergenic
996404067 5:123089732-123089754 AATGCTGGGGCCCGACAGGAGGG - Intronic
999381137 5:151122339-151122361 AAAACAGGGGTTCCACATGAGGG + Intronic
999793109 5:154961596-154961618 AATCCTGTTGCTCCAAATGAAGG + Intronic
1002915867 6:1527261-1527283 AATGCTCGGGTTTCACATGAAGG - Intergenic
1005153176 6:22775817-22775839 AGTTTGGGAGCTCCACATGAGGG + Intergenic
1008201489 6:48596487-48596509 GATTCAGGGGGTACACATGAAGG + Intergenic
1014973306 6:127846143-127846165 ACTTCTGTGGCCACACATGATGG + Intronic
1016756834 6:147696576-147696598 AATGCTGGGAATCCACAGGAAGG - Intronic
1020862399 7:13511132-13511154 AAGTTTGGGGGTGCACATGAAGG + Intergenic
1022575849 7:31496302-31496324 AATCCTGGGGCTCCTTTTGATGG + Intergenic
1023758406 7:43441284-43441306 AATTGCAGGGCTCCACATGTAGG - Intronic
1023851189 7:44151399-44151421 ATTCCTGAGGCTCCACATGGAGG + Intronic
1028748894 7:94359873-94359895 GATTCTGGGGATACACATGCAGG - Intergenic
1032622956 7:133556689-133556711 AATTATGGGGCTGGACATGAGGG + Intronic
1034378532 7:150667956-150667978 AATGCTGGGGGTCCACTGGAAGG - Intergenic
1035890122 8:3334226-3334248 ATTTCAGGGACTCCAAATGATGG + Intronic
1036626762 8:10479025-10479047 AATTCTCAGGCTCCAGAAGATGG + Intergenic
1037031622 8:14113461-14113483 TATTCTTGCGCACCACATGATGG + Intronic
1037624888 8:20597999-20598021 AATTATGGAGCTGCACATGATGG - Intergenic
1037700705 8:21271677-21271699 CACTCTGGGGCTCCCCAAGATGG - Intergenic
1043740492 8:83804941-83804963 ATTTCTGAGGCTCCAGAGGAAGG - Intergenic
1045246092 8:100442750-100442772 AAGTCTGGGGCTGCTCATGGTGG + Intergenic
1045683599 8:104688655-104688677 AATTCTGGGTCTCCCCCTGGAGG - Intronic
1048279527 8:133094899-133094921 CATTCTGGGGCTGCACACAATGG - Intronic
1053138075 9:35664308-35664330 AAGTTTGGGTCTCCAGATGAAGG + Intronic
1055951354 9:81732721-81732743 ACTTCTGGATCTCCACAAGAAGG - Intergenic
1057287774 9:93774290-93774312 AATTCTGGGACTGAACAGGATGG + Intergenic
1059575774 9:115486797-115486819 CCTTCTGAGGCACCACATGACGG - Intergenic
1186128303 X:6439859-6439881 GATTCTGGGGGTACACATGCAGG + Intergenic
1190428304 X:50353165-50353187 AATTCTGGAGCTTTACATCAAGG + Intergenic
1193240066 X:79158005-79158027 AATACTTGGGTTACACATGAAGG - Intergenic
1193564342 X:83059037-83059059 ACTTCTGGGGCTCCTCAGGAAGG + Intergenic
1195375533 X:104223711-104223733 CATTCTGGGGCTCAGGATGAAGG + Intergenic
1196260547 X:113575295-113575317 AATTCTGGCCCTCTACATGATGG + Intergenic
1198075479 X:133189644-133189666 AATTCTTGGGCTGCTCTTGAAGG + Intergenic
1199766108 X:150942721-150942743 AGTTCTGGGCCTTCACAGGATGG - Intergenic
1200109382 X:153732559-153732581 AATTCGGGGACTGCACATCAAGG + Intronic