ID: 962839196

View in Genome Browser
Species Human (GRCh38)
Location 3:139218291-139218313
Sequence CCCTGTGCAGGCCTGTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 266}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962839196_962839210 22 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839210 3:139218336-139218358 GCAGTGAGAGGGGAATGGCGGGG 0: 1
1: 0
2: 3
3: 25
4: 382
962839196_962839208 20 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839208 3:139218334-139218356 TGGCAGTGAGAGGGGAATGGCGG 0: 2
1: 0
2: 4
3: 50
4: 595
962839196_962839201 -5 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839201 3:139218309-139218331 CAGGGGTGAATGGCTCAGCGAGG 0: 1
1: 0
2: 0
3: 12
4: 128
962839196_962839202 0 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839202 3:139218314-139218336 GTGAATGGCTCAGCGAGGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 147
962839196_962839209 21 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839209 3:139218335-139218357 GGCAGTGAGAGGGGAATGGCGGG 0: 1
1: 0
2: 1
3: 62
4: 699
962839196_962839206 17 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839206 3:139218331-139218353 GCCTGGCAGTGAGAGGGGAATGG 0: 1
1: 0
2: 3
3: 54
4: 566
962839196_962839205 12 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839205 3:139218326-139218348 GCGAGGCCTGGCAGTGAGAGGGG 0: 1
1: 0
2: 1
3: 38
4: 258
962839196_962839204 11 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839204 3:139218325-139218347 AGCGAGGCCTGGCAGTGAGAGGG 0: 1
1: 0
2: 2
3: 38
4: 325
962839196_962839203 10 Left 962839196 3:139218291-139218313 CCTTTGCACAGGCCTGCACAGGG 0: 1
1: 0
2: 3
3: 23
4: 266
Right 962839203 3:139218324-139218346 CAGCGAGGCCTGGCAGTGAGAGG 0: 1
1: 0
2: 2
3: 40
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962839196 Original CRISPR CCCTGTGCAGGCCTGTGCAA AGG (reversed) Intronic
900577694 1:3391830-3391852 CCCTGTGCACGCCTGTGCTTGGG - Intronic
900920174 1:5665023-5665045 CCATGAGCAGGGCTGTGCATTGG + Intergenic
901107603 1:6769427-6769449 CCCAGTCCAGCCCTGTCCAAAGG - Intergenic
901621338 1:10590260-10590282 CCCTGTGCAGGCCTGCCGAGGGG - Intronic
902207063 1:14876487-14876509 TCCTGTGCAGGTCTTTGCAGGGG + Intronic
902625654 1:17674624-17674646 GCCTGTGCATGCCTGTGAGAGGG + Intronic
902811169 1:18888843-18888865 CCCTGGGCAGACGTGTGCAGGGG - Intronic
903673681 1:25051445-25051467 CATTGTGCAGGCGTGTGCACTGG - Intergenic
904403806 1:30273535-30273557 AGCTGAGCAGGCCTGGGCAAAGG - Intergenic
904609701 1:31718713-31718735 GCCTGTGCAGGCCTGGGAAGGGG - Intergenic
904614647 1:31743230-31743252 CCCTGTGGACGCCTGGACAAGGG + Intronic
905517075 1:38569799-38569821 CCCTGGGCAGCCCTGTGGAAAGG + Intergenic
906730601 1:48077689-48077711 CCCTGGGCATGCCTGGGTAAGGG + Intergenic
906960227 1:50415651-50415673 CCCTGTTCCTGACTGTGCAATGG + Intergenic
913213179 1:116598704-116598726 ACCTGTGCAGGCAAGGGCAAGGG - Intronic
914241669 1:145857040-145857062 GGCAGGGCAGGCCTGTGCAAGGG - Intronic
915067703 1:153240293-153240315 GCATGTGCAGGCCATTGCAAGGG - Intergenic
915835218 1:159171275-159171297 GCCACTGCAGGCCTGGGCAAGGG - Intergenic
916381432 1:164216472-164216494 ACCTATGCAAGCCTGGGCAATGG - Intergenic
916732672 1:167580511-167580533 CCATGGGCAGGCCAGTTCAAAGG + Intergenic
916879481 1:169005901-169005923 CCATGTGCAGAGCTGGGCAAAGG + Intergenic
917592604 1:176492191-176492213 ATCTGTGCATGGCTGTGCAAGGG - Intronic
917638710 1:176961434-176961456 CCCTTTGCAGTTCTCTGCAAAGG - Intronic
917710608 1:177680437-177680459 TCCTTTGCAGGTCTGGGCAATGG - Intergenic
918259248 1:182780305-182780327 ACCTGTGCAGGCCTAGGCCAAGG - Intergenic
918371461 1:183865601-183865623 CCCTCTGCATGTCTATGCAAGGG - Intronic
919715913 1:200776536-200776558 ACCTGGGCAGGCTTGTGCACAGG + Intronic
920762617 1:208800124-208800146 ACCTGTGCCAGCCTGTGCACTGG + Intergenic
921101728 1:211934385-211934407 CCCTGTGCAGCCCTTCACAAAGG - Intergenic
922614710 1:226954989-226955011 CCTCCTGCAGGCCTGTGCAGAGG - Intronic
923200723 1:231708528-231708550 CCCTTTGCAGGTCTGTTCCATGG + Intronic
1062983398 10:1744494-1744516 CCCTGGCCTGGCCTGTGCCAGGG + Intergenic
1069325901 10:67231109-67231131 ACCTAAGCAGGCCTGGGCAATGG - Intronic
1069954259 10:72040242-72040264 CCCTGCAGAGGCCTGTGCCATGG - Intergenic
1074665205 10:115714486-115714508 CCTTTGACAGGCCTGTGCAATGG - Intronic
1075330486 10:121570374-121570396 CCCTGTGCCTGCATGTGCAAAGG + Intronic
1075642956 10:124078200-124078222 CACTGTGCAGGCCTGAGCCAAGG + Intronic
1075729062 10:124625590-124625612 CCCTGGCCAGGCCTGGGCGATGG + Intronic
1075846110 10:125546072-125546094 CCCTTTGGAGGCCCGTTCAAGGG - Intergenic
1077424316 11:2467227-2467249 CCCCATGGAGCCCTGTGCAATGG - Intronic
1078148496 11:8738920-8738942 CCCAGTGGAGGCCTCTGCATAGG - Intronic
1078855809 11:15205875-15205897 CTCTGTGTTGGCCTGGGCAAGGG + Intronic
1081172064 11:39881510-39881532 ACCTATGCAAGCCTGGGCAATGG - Intergenic
1081235243 11:40639298-40639320 GCTGGTGCAGGCCAGTGCAAGGG - Intronic
1081340550 11:41922122-41922144 CCCTTTGCTGGCTTGTTCAAAGG - Intergenic
1081697741 11:45128027-45128049 ACCTATGCAAGCCTGGGCAATGG + Intronic
1081906656 11:46674575-46674597 CCCAGTGCAGGTCTGGGAAAGGG + Intronic
1083233751 11:61339156-61339178 ACCTGTGCCGGCCTGGGCCACGG - Exonic
1083399019 11:62411289-62411311 CCCAGAGCTGGCCTGTACAATGG + Intronic
1083492379 11:63022440-63022462 TGCAGAGCAGGCCTGTGCAAGGG - Intergenic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084491840 11:69483155-69483177 CCCAGAGCAGGTCTGTGCAAGGG + Intergenic
1084959153 11:72707162-72707184 CGCTGTGCAGGTGTGTGCATGGG - Exonic
1085411406 11:76292781-76292803 CTCTGTCCTGCCCTGTGCAAGGG + Intergenic
1085470495 11:76754288-76754310 CCCTGGGCTGGCCTGTCCCAAGG - Intergenic
1085534872 11:77211764-77211786 CCCTGAGCAGGCCTGTCCCCAGG + Intronic
1086044849 11:82520827-82520849 CCCTGTGCAGGTCTCTGAACTGG + Intergenic
1086084138 11:82937818-82937840 CTGTGTGTAGGCCTGTGCATTGG - Intronic
1088204148 11:107373205-107373227 ACCTGAGCAAGCCTGGGCAATGG - Intronic
1090237528 11:125160356-125160378 CACTGGGCAGCCCTGTGTAAAGG + Intergenic
1090385277 11:126354904-126354926 CACTGTGCTGACCTGTGAAAGGG + Intergenic
1092115208 12:5996210-5996232 CTCTGTCCAGGCGTGTGCACAGG - Exonic
1092733465 12:11556861-11556883 CCCTCTCCAGGCCGGTGCCAAGG - Intergenic
1093677649 12:21962636-21962658 CCCTGTGCAAGCTTCAGCAATGG - Intergenic
1095940611 12:47724534-47724556 TCCTGTGTAGGACTGTGGAAAGG - Intronic
1095951334 12:47783535-47783557 CTCTGTGCAGTCCTGAGGAATGG + Exonic
1096021009 12:48325730-48325752 ACCTATGCAAGCCTGGGCAATGG + Intergenic
1097972643 12:65651017-65651039 CCTTGTGAAGGCCTCTGAAATGG + Intergenic
1098430526 12:70414562-70414584 CCCTGAGCTGGCCAGTGCAGAGG + Intronic
1098826757 12:75306394-75306416 CCCTCACCAGGCCTGTGGAAGGG + Intronic
1103339423 12:120213605-120213627 CCCAGTCCAGCCCTGTGCAGCGG - Intronic
1103606004 12:122086709-122086731 CCTCGTGCTGGCCTGTGGAATGG + Intronic
1103708153 12:122890891-122890913 CCCTGTGCAGGGCATTGTAAGGG - Intronic
1103915728 12:124374677-124374699 CCCTGAGCAGGCTGGTCCAATGG + Intronic
1104353893 12:128068237-128068259 CCCTCTGCAGGCAGGTGCTAGGG + Intergenic
1104556125 12:129801149-129801171 ACCTGAGCAAGCCTGGGCAATGG - Intronic
1105857399 13:24385725-24385747 CCCTGTGCAGCCCTCTCCACTGG - Intergenic
1106076888 13:26468129-26468151 CTCTGTGCAGGGCTGTGCAGGGG - Intergenic
1106555402 13:30804402-30804424 CCCTGTGAAGGCCCGTGGGATGG - Intergenic
1108296081 13:49019159-49019181 ACCTGAGCAAGCCTGGGCAATGG + Intronic
1113564953 13:111314191-111314213 CCCTGAGCAGGTCAGTGCCATGG - Intergenic
1113773592 13:112929125-112929147 CCCTGTGCAGGCAGGAGAAAGGG - Intronic
1114524311 14:23358915-23358937 CCCTGTGCAGGCCTGATCCGGGG + Exonic
1115832340 14:37356464-37356486 CCCTAAGCAAGCCTGGGCAATGG + Intronic
1117744914 14:58860101-58860123 CCATTTGCAGGCCTGGGCACTGG - Intergenic
1117831079 14:59751691-59751713 CCCTGTGGTGGCCTTTGCAGTGG - Intronic
1118391131 14:65296591-65296613 CCCTGAGCAGGGCTGAGTAATGG + Intergenic
1119405466 14:74396035-74396057 CACTGTGCAGGCCTCTGCCCAGG - Intergenic
1119740260 14:77009457-77009479 CCCTCTGGAGGCCTGAGCAGGGG - Intergenic
1120157948 14:81114614-81114636 ACCTAAGCACGCCTGTGCAATGG - Intronic
1121115338 14:91339090-91339112 CCCTGTGCAGGCCTCAGAAGGGG + Intronic
1121434147 14:93907867-93907889 CCCAGAGCTGGCCTGTGCTACGG - Intergenic
1122118700 14:99540609-99540631 CCCTGGGCTGGCCTGGCCAAGGG + Intronic
1122640427 14:103156186-103156208 CCCCATGCAGGCCTGGGCAGGGG + Intergenic
1123932964 15:25180729-25180751 CCCTGTGCAGGCTTGGGCTCTGG + Intergenic
1123977697 15:25568585-25568607 CAGTGTTCAGGCCTGTGCCAGGG - Intergenic
1124038102 15:26075221-26075243 CCCTGTGCAGGTATGAACAAAGG - Intergenic
1125600293 15:40912024-40912046 CCCAGCTCAGGCCTGTGGAAGGG - Intergenic
1127114192 15:55708112-55708134 GTCTGTGCACGCCTGTGGAAAGG + Intronic
1127905425 15:63372684-63372706 ACCTGTGCAGCCCTGAGCACAGG + Intronic
1128333851 15:66773716-66773738 CTCAGTGCAGCCCTGTGCAAAGG + Intronic
1129330075 15:74822632-74822654 CCCTCTGCAGGACTCTGCCAAGG + Exonic
1131389011 15:92032234-92032256 CCATGTGCAGGCGTGTGGCAGGG + Intronic
1131721139 15:95170183-95170205 CCCTGTTCAGTTCTGTGCATGGG - Intergenic
1131862464 15:96668400-96668422 CCTTGTGAAGTCCTGAGCAAAGG + Intergenic
1132666298 16:1082765-1082787 CCCTGTCCAGGCCTGGAGAAGGG + Intergenic
1132939773 16:2500951-2500973 CCCAGTGACGGCCTGTGCCACGG + Exonic
1132977323 16:2717215-2717237 CCCCCTGCTGGGCTGTGCAAGGG + Intronic
1137526253 16:49239021-49239043 CCCCTTGGAGGCTTGTGCAAAGG - Intergenic
1138147822 16:54627934-54627956 CCATGTGCAAGCCTCTGCACTGG + Intergenic
1138209759 16:55153708-55153730 CCCTGAGCAGTGCTGTTCAAAGG - Intergenic
1138584442 16:57960903-57960925 CCCTCTGCAGGCCTGGGCTGCGG - Exonic
1141169861 16:81684478-81684500 CCCTGTGCTGCCCTGTGGACAGG - Intronic
1142932482 17:3298780-3298802 CACTGTGCAGGCCTGTGCTCCGG + Intergenic
1143602740 17:7959700-7959722 TCCTGGGCAGTCTTGTGCAATGG + Intergenic
1144749562 17:17639054-17639076 CCATGTGAAGCCCTGTGCCATGG + Intergenic
1147988315 17:44318970-44318992 CCCTGTGCTGGCCTCAGCAATGG + Intergenic
1148082963 17:44977631-44977653 CAAGGTGCAGGCCTGTGCATGGG - Intergenic
1148690159 17:49522567-49522589 ACCTTAGCAGGCCTGTCCAAGGG - Intergenic
1148747674 17:49927591-49927613 CCCACTGCAGGCCAGTGCACTGG + Intergenic
1150011017 17:61503800-61503822 CCCTGTGTAGGCCTAGGCTAAGG - Intergenic
1151631547 17:75314407-75314429 CGTGCTGCAGGCCTGTGCAAGGG - Intergenic
1151653421 17:75484153-75484175 CCCAGGGCAGGACTGTGCAGAGG - Intronic
1152070787 17:78132683-78132705 CCCTGGGGAGGCCTGGGCAGGGG - Intronic
1153019155 18:611128-611150 CCCTGTGCTGGGCTGAGCCAGGG - Intronic
1153399478 18:4667246-4667268 CTCTGTGCAGGCATTTGCAGTGG - Intergenic
1154110797 18:11566801-11566823 CGCTGTGCAGGGCTCTGGAAGGG - Intergenic
1158628425 18:59091468-59091490 CGCTGGGCAGGCCTGTGGCATGG + Intergenic
1158683885 18:59595187-59595209 TACTGGCCAGGCCTGTGCAAGGG - Intronic
1158844313 18:61425483-61425505 CTCTGGGCAGGCCTTTGCTATGG - Intronic
1159308270 18:66674217-66674239 GCTTGGGCAGGCCTGTGGAAGGG - Intergenic
1160861703 19:1239979-1240001 CCGTGTTCAGGCCAGTGCAATGG - Intergenic
1161657890 19:5526936-5526958 CCCTGTTCTGGGCTGTGAAATGG + Intergenic
1161953036 19:7478219-7478241 CCCTGTGCAGGCCCATGCTGGGG - Intronic
1163418655 19:17202088-17202110 CACCCTGCAGGCCTGGGCAAGGG - Intronic
1163676957 19:18660133-18660155 CCCAGTGCAGGGATGTGCTAGGG - Intronic
1163950936 19:20585550-20585572 CCATGTGCAGGTTTGTGAAATGG - Intronic
1164761990 19:30735141-30735163 GCCTGTGCAGGAGGGTGCAATGG + Intergenic
1165037207 19:33042296-33042318 CACAGAGCAGGCCTGTCCAAGGG + Intronic
1165111565 19:33505447-33505469 CCCTGGGCAGGCCTGGTCACTGG - Intronic
1166295686 19:41888181-41888203 GCCTGGGGAGGCCTGTGGAAAGG - Exonic
1167644274 19:50697247-50697269 CTCTGTGCAGTCATGTGCAGTGG - Intronic
1167694086 19:51003723-51003745 CTCTGTGCGGGCCTGTGGGAGGG - Exonic
925921292 2:8639545-8639567 ACCTGTGCAGGCATGTGCATTGG + Intergenic
926806940 2:16719797-16719819 CCATGTGCAGGTTTGTACAAAGG + Intergenic
926830477 2:16957021-16957043 CCCCGTGGAGGACTGTCCAAAGG + Intergenic
927099405 2:19776417-19776439 AGCTGTGCTGGCCTGTGCAGAGG - Intergenic
927206747 2:20615945-20615967 CCCTGGCCAGGCCTGTGTCATGG - Intronic
927875127 2:26650161-26650183 ACGTGTGAAGGCCTGGGCAAAGG + Intergenic
928433819 2:31240878-31240900 CCCTAAGCAGGGCTCTGCAAGGG - Intronic
928853153 2:35772768-35772790 CCTTGTGAAGTCCTGAGCAAAGG + Intergenic
929580621 2:43079783-43079805 ACATGTGCAGCCCTGTGCCAGGG + Intergenic
931887457 2:66632767-66632789 ACCTAAGCAGGCCTGGGCAATGG + Intergenic
932665920 2:73698869-73698891 CCCTGTGCAGGCTTCTGCCTGGG - Intergenic
933652810 2:84862794-84862816 TCCTGAGCAGGCCTGTGCCCAGG + Intronic
934297899 2:91757408-91757430 ACCTGTGCAGGCAAGGGCAAGGG + Intergenic
936624411 2:114133045-114133067 CCCTTTGCATACCTGTGCCATGG + Intergenic
944910971 2:204310199-204310221 CCCTGTGCGGTCCATTGCAAAGG - Intergenic
944922370 2:204428883-204428905 CCCTCTGGAGGCCTTAGCAAGGG - Intergenic
947432982 2:230046710-230046732 GCCTGTACAGGCCTGGGCAGCGG - Exonic
947459792 2:230293754-230293776 CCCTGGGAAGGCCTGGTCAATGG - Intronic
948296229 2:236862730-236862752 GCCTCTGCAGGACTCTGCAAAGG + Intergenic
948660785 2:239505373-239505395 CCCTGGGCAGGCCTGTTGGACGG + Intergenic
1169219992 20:3816601-3816623 CTCTGTGCAGACAGGTGCAATGG - Intergenic
1170815531 20:19710654-19710676 CACTGTGCAGGCCTGTCCAAAGG + Intronic
1171471411 20:25374904-25374926 CACTCTGCATGCCTGTGCTATGG + Intronic
1173543069 20:43869131-43869153 CCCTGAGCAGGCCTGTGCACCGG - Intergenic
1173585032 20:44175902-44175924 TTCTGGGCAGGCCTGTGCACAGG - Intronic
1173774571 20:45693510-45693532 ACCTAAGCAAGCCTGTGCAATGG + Intronic
1174427063 20:50439312-50439334 CCCACTGCAGGCCTGGGCAGAGG - Intergenic
1175059841 20:56231956-56231978 TCATGGGCAGACCTGTGCAATGG - Intergenic
1175334588 20:58186972-58186994 CCCTGGTCAGGCAGGTGCAATGG + Intergenic
1175554161 20:59835948-59835970 CCCTGTGCTGGGCTGGGCACAGG + Intronic
1177332437 21:19681016-19681038 CCCTGTGCAAACCAGTACAAGGG + Intergenic
1178716290 21:34967517-34967539 CCCTGTGCATGCCTGCAAAAGGG - Intronic
1179312594 21:40209788-40209810 GCCTGTGCTGGGCTGTGAAATGG + Intronic
1180523850 22:16235495-16235517 ACCTATGCAAGCCTGGGCAATGG - Intergenic
1180988203 22:19917869-19917891 CCCTGTGCAGCCCTGGGCTCTGG + Intronic
1181043494 22:20203948-20203970 CCCTGTGGAGGCCTGTGGAATGG + Intergenic
1181604328 22:23971191-23971213 CCATCTGCAGGCCTGTGGGAAGG - Intronic
1182529367 22:30943572-30943594 CCATCTGCAGGGCTCTGCAAGGG - Intronic
1182969134 22:34555239-34555261 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
1183927927 22:41219070-41219092 CCCTGTGCCAGCCCGAGCAATGG - Intronic
1184834845 22:47014989-47015011 CTCTGTGCAGGTGTGTGCACAGG - Intronic
950107412 3:10396977-10396999 CCCTGTGCAGCACTGTGCTAGGG + Intronic
950167837 3:10815084-10815106 ACTTTTCCAGGCCTGTGCAATGG + Intergenic
953610810 3:44445924-44445946 GCCTATGCAGGCCTGTGGGATGG + Exonic
954950070 3:54464456-54464478 CCCTAAGCAAGCCTGGGCAATGG + Intronic
955038741 3:55293916-55293938 GCCTGTGTAGGCTTGTGCTACGG - Intergenic
956793000 3:72694420-72694442 CCCTGAGCTGCCCTGTGAAAAGG - Intergenic
958271366 3:91503488-91503510 ACCTGTGCAGGACTGTGGTAAGG - Intergenic
958672208 3:97219588-97219610 CTCTGTGCAGCCCTGTGACATGG - Intronic
958750283 3:98187221-98187243 CCCTGTGCAAGCCGGTAAAAGGG - Intronic
960962316 3:123080812-123080834 CCCTGTGCAGGCTTCTGCATGGG - Intronic
961340071 3:126212093-126212115 CTCTGTGCAGGCCTATGGAAAGG + Intergenic
962713189 3:138104314-138104336 CACTGTGCAGGCCTGTGGTGAGG + Intronic
962839196 3:139218291-139218313 CCCTGTGCAGGCCTGTGCAAAGG - Intronic
964563136 3:158020124-158020146 ACCTGAGCAAGCCTGGGCAATGG - Intergenic
968876253 4:3269360-3269382 CCCTGTGCAGGCCTGGGGCATGG - Intronic
969213793 4:5707880-5707902 CCCAGTGCTGGCCTCTGCAAGGG + Intronic
969575357 4:8033385-8033407 CCCTGTGAAGCCCTGTGCCATGG + Intronic
969696435 4:8737755-8737777 CCATCTGCAGGACTGTGCCATGG + Intergenic
969928310 4:10606249-10606271 CCCTATGCAGGCCTAGGCTAAGG - Intronic
970177098 4:13350479-13350501 CCCTCTGGGGGCCTTTGCAAGGG + Intergenic
976154212 4:82125387-82125409 TCCTGTGCTGTCCTCTGCAAAGG + Intergenic
976455655 4:85244206-85244228 CCCTGACCAGGCCTATGGAATGG - Intergenic
977555221 4:98481376-98481398 CTCTGAGCATGCCTGTGAAATGG - Intronic
979960982 4:127021015-127021037 ACCTAAGCAGGCCTGGGCAATGG - Intergenic
981029852 4:140113363-140113385 CCTTGTAAAGGGCTGTGCAAGGG + Intronic
984449710 4:179883641-179883663 CTCTGTTCAGGCCTGTGCTGTGG + Intergenic
985432399 4:189893924-189893946 CCCTCTGCAGGGCTGTCCACGGG - Intergenic
985630649 5:1012342-1012364 CCCCGTGCAGGCCAGGGCCACGG - Intronic
985880670 5:2636664-2636686 CCCTGTGGAGTCTTGTGCAAAGG + Intergenic
986308798 5:6536000-6536022 CCCTGGTCAGGGCTGTGGAATGG - Intergenic
986311256 5:6552720-6552742 CCCTGTGCAGCCCTGGACACAGG - Intergenic
986439051 5:7762513-7762535 ACCTGTGCAGGGTGGTGCAAGGG + Intronic
989816956 5:45748725-45748747 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
990030295 5:51251191-51251213 ACCTAAGCAAGCCTGTGCAATGG - Intergenic
990135999 5:52644981-52645003 CTCTGTGCAGCCCTGTGACATGG + Intergenic
991984837 5:72274398-72274420 CCCTGTGCAGGCCTAAGCTAAGG - Intronic
996162412 5:120181705-120181727 CCCTATGCAAGCCTGGGCAATGG + Intergenic
997351333 5:133233525-133233547 CCCTGTGCAGGACTTTGGAGAGG - Exonic
997431523 5:133844311-133844333 CCCTGTGCAGGCCTGGGAGTGGG - Intergenic
997697296 5:135871747-135871769 CCCTGTGCAGGCCACAGCAGTGG + Intronic
998149920 5:139750998-139751020 TCCTGTGCAGGCCTCTCCCATGG + Intergenic
1000797401 5:165682254-165682276 CACTGTGCATGCCTGGGGAAGGG - Intergenic
1003961721 6:11215094-11215116 CGCTCTGGAGGGCTGTGCAATGG + Intronic
1004230860 6:13831806-13831828 CACTGTGTAGGCCTCTCCAAGGG - Intergenic
1006318416 6:33304586-33304608 CCCTGGGGCGGCCCGTGCAAGGG + Exonic
1006411994 6:33879144-33879166 CTCTGGGCTGGCATGTGCAATGG + Intergenic
1006719686 6:36142305-36142327 CCCAGTGCAGCCCAGTGCACAGG + Intronic
1007484791 6:42173595-42173617 CCCCCTGAAGGCCTGAGCAATGG + Exonic
1007721599 6:43888453-43888475 CCCTGTGCCTGCCTGTGCCAAGG - Intergenic
1008297600 6:49797041-49797063 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
1008983768 6:57517820-57517842 ACCTGTGCAGGACTGTGGTAAGG + Intronic
1009171827 6:60410729-60410751 ACCTGTGCAGGACTGTGGTAAGG + Intergenic
1009613021 6:65971448-65971470 ACCTAAGCAGGCCTGGGCAATGG - Intergenic
1010388737 6:75312358-75312380 CCCTCTGCAGGCCTGCGCTTTGG + Intronic
1010593373 6:77736192-77736214 CCCTAAGCAAGCCTGGGCAATGG + Intronic
1013197695 6:107860277-107860299 ACCTAAGCAGGCCTGGGCAATGG + Intergenic
1014381531 6:120748801-120748823 ACCTATGCAAGCCTGGGCAATGG - Intergenic
1016405137 6:143721819-143721841 CCCAGTGCAGGTGTGTGCTAGGG + Intronic
1017163480 6:151388245-151388267 TCCTGTGCAGGCTGGTGCCACGG + Intronic
1017499166 6:155007220-155007242 TCCTATGCAAGCCTATGCAAAGG - Intronic
1017816723 6:158021662-158021684 CCCTCTGCTAGCCTGTGCAGAGG - Intronic
1019188808 6:170238194-170238216 CCCGGTGCTGGGCTGGGCAAAGG + Intergenic
1022152032 7:27618071-27618093 CCCTGTGCTTGGCTTTGCAAAGG + Intronic
1022674074 7:32482066-32482088 CTCTGAGCAGGCCTGTGTTATGG + Intergenic
1023880152 7:44313640-44313662 CCCTGTGCTGGTCTCTGGAAAGG + Intronic
1027028186 7:74869721-74869743 GCCTGTGCAGGCCTGTTTTATGG - Intergenic
1027059567 7:75074358-75074380 GCCTGTGCAGGCCTGTTTTATGG + Intergenic
1030545979 7:110895541-110895563 CCCTGTCCATGTCTGTGCAAAGG + Intronic
1033238559 7:139657913-139657935 CCCTGTGCAGACCTCTTAAAGGG - Intronic
1035358375 7:158293788-158293810 CCCTGTGTAGGCCTAGGCTAGGG - Intronic
1035877343 8:3205596-3205618 CCCTGTGGAGGCCAGTACACGGG - Exonic
1035952268 8:4035550-4035572 CCCCGTGCAGGCCTAGGCTAGGG + Intronic
1036139896 8:6197911-6197933 CTCTGTGGATGCCTGTGCAATGG - Intergenic
1036207398 8:6815301-6815323 TCCAGTGCAGGCCTGAGCACAGG - Intronic
1036664238 8:10728723-10728745 TTCTGTGCAGGCCTGGGCCAGGG - Intronic
1039789930 8:40867421-40867443 CACTGGGGAGGCCTGAGCAAAGG - Intronic
1042620699 8:70700867-70700889 ACCTGAGCAAGCCTGGGCAATGG + Intronic
1045694193 8:104789254-104789276 CTCTGTGCAGGCCTGTGGGCAGG - Intronic
1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG + Intergenic
1049355996 8:142188360-142188382 CCATGTGCAGGTGTGTGCTACGG - Intergenic
1049851562 8:144834383-144834405 CACTGTGCTGGCCACTGCAAAGG - Intronic
1051725365 9:20083381-20083403 CCCTGTTCAGACCTGGGCTATGG - Intergenic
1053434570 9:38066861-38066883 CCCAGCCCAGGCCTGGGCAAAGG + Intronic
1054852343 9:69860785-69860807 CCCTGTGTAGGCCTAGGCTAAGG - Intronic
1055069901 9:72155494-72155516 GCCTGTGACTGCCTGTGCAAAGG + Intronic
1055086705 9:72321416-72321438 CACTGTGCAGGCCTAGGCTAAGG + Intergenic
1056093555 9:83228491-83228513 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
1056760014 9:89407790-89407812 CCCTCTGCATGGCTGTGTAACGG + Intronic
1060444661 9:123677199-123677221 CCCACTGCAGGCATCTGCAAAGG + Intronic
1061159525 9:128885148-128885170 CACTGTGCAGAACTGTGCATGGG - Intronic
1061231348 9:129317730-129317752 CCCGGCTCTGGCCTGTGCAACGG + Intergenic
1061872749 9:133529397-133529419 CCCTTTGCAGGGCTGTGGGATGG + Intergenic
1062044486 9:134418713-134418735 CCCTGTGGTGGCCAGTGCCAGGG - Intronic
1062215234 9:135385526-135385548 GCCAGTGCTGGCCTGTGCAGAGG - Intergenic
1062534967 9:137017396-137017418 TCCTGGGCAGGCCCGTGCCAGGG + Intronic
1185644687 X:1608575-1608597 CCCTGTGCAGGCCGATCCAGTGG - Intergenic
1188176128 X:26993070-26993092 CTCTTTGCAGTCCTTTGCAAAGG + Intergenic
1189334971 X:40165476-40165498 CCCTGTGCAGGAGAGTCCAAGGG + Intronic
1191003519 X:55686714-55686736 ACCTAAGCAAGCCTGTGCAATGG + Intergenic
1191728029 X:64302123-64302145 ACCTGAGCAAGCCTGGGCAATGG + Intronic
1192096484 X:68217363-68217385 ACCTATGCAAGCCTGGGCAATGG - Intronic
1192156086 X:68747708-68747730 CTCTGTGCTGGCCTCTGCCAGGG - Intergenic
1194641507 X:96408689-96408711 CCTTGTTCATCCCTGTGCAAAGG + Intergenic
1195971690 X:110480396-110480418 CCCTATGCCGGCCTGTCCCAGGG - Intergenic
1197892255 X:131279163-131279185 TCTTTTGCAGGACTGTGCAATGG - Exonic
1200136042 X:153875340-153875362 CCCTCAGCTGGCTTGTGCAAAGG - Intronic
1200943278 Y:8806899-8806921 CCCTGTGTAACCCTGTACAAAGG - Intergenic
1201303925 Y:12534570-12534592 CCCTGTAGAGGCCTCTGCCATGG - Intergenic
1201588734 Y:15590523-15590545 ACCTAAGCAAGCCTGTGCAATGG + Intergenic