ID: 962843101

View in Genome Browser
Species Human (GRCh38)
Location 3:139252873-139252895
Sequence CGGGGCTGTCCCCAGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962843101_962843107 -10 Left 962843101 3:139252873-139252895 CCCCTCTTCTGGGGACAGCCCCG 0: 1
1: 0
2: 3
3: 15
4: 144
Right 962843107 3:139252886-139252908 GACAGCCCCGGCAGGGTCCATGG 0: 1
1: 0
2: 2
3: 12
4: 178
962843101_962843108 -9 Left 962843101 3:139252873-139252895 CCCCTCTTCTGGGGACAGCCCCG 0: 1
1: 0
2: 3
3: 15
4: 144
Right 962843108 3:139252887-139252909 ACAGCCCCGGCAGGGTCCATGGG 0: 1
1: 0
2: 0
3: 2
4: 99
962843101_962843114 7 Left 962843101 3:139252873-139252895 CCCCTCTTCTGGGGACAGCCCCG 0: 1
1: 0
2: 3
3: 15
4: 144
Right 962843114 3:139252903-139252925 CCATGGGAACATGAGGCTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 230
962843101_962843112 0 Left 962843101 3:139252873-139252895 CCCCTCTTCTGGGGACAGCCCCG 0: 1
1: 0
2: 3
3: 15
4: 144
Right 962843112 3:139252896-139252918 GCAGGGTCCATGGGAACATGAGG 0: 1
1: 0
2: 3
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962843101 Original CRISPR CGGGGCTGTCCCCAGAAGAG GGG (reversed) Intronic