ID: 962846286

View in Genome Browser
Species Human (GRCh38)
Location 3:139276571-139276593
Sequence TTGAGGCCCCAGCATTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962846286 Original CRISPR TTGAGGCCCCAGCATTATGC AGG (reversed) Intronic
901101367 1:6721531-6721553 TTCAGGCCCCAGCATGCTACAGG + Intergenic
903141489 1:21341893-21341915 TTGTAGTCCCAGCATTTTGCGGG - Intronic
903947953 1:26975858-26975880 TTGGGGCTCCAGCATTGTGTTGG - Intergenic
905292442 1:36931583-36931605 TTGAGCGCCCAGCACAATGCTGG + Intronic
905431520 1:37927994-37928016 TTGAGGCCCAGGCATTTTGGGGG - Intronic
906963548 1:50434536-50434558 TTAAGGCCCTAGCAGTGTGCTGG + Intergenic
913314100 1:117535420-117535442 TGGAGGCCCCAGCAGGCTGCTGG - Intergenic
915583593 1:156831038-156831060 TTCAGGGCCCAGCAGCATGCAGG - Intronic
919175315 1:194011409-194011431 GGGAGGCCTCAGAATTATGCTGG - Intergenic
920097745 1:203497614-203497636 GTGAGGCCTCAGCAATCTGCTGG + Intronic
922062288 1:222104177-222104199 TTGGGGTCCCAGCATCCTGCAGG + Intergenic
1066746713 10:38608569-38608591 CTGAGGCTCTATCATTATGCAGG - Intergenic
1067039525 10:42941647-42941669 TTGAAGCCCCTGCATTATGGAGG - Intergenic
1067549619 10:47225364-47225386 TTGAGGCCCCAGCTTCAGGTAGG - Intergenic
1072065029 10:91859709-91859731 TTGAGGGCAAAGCATTATGTTGG + Intronic
1075002897 10:118810927-118810949 TGGGGGCCCCAGCATCCTGCTGG + Intergenic
1076734973 10:132454751-132454773 TCGAGACCCCAGCATGATTCCGG + Intergenic
1077158547 11:1102306-1102328 TTCAGGCCCCAGCTTCCTGCTGG + Intergenic
1079495789 11:21042553-21042575 CTGAGGCCCCAGCTTTTGGCTGG - Intronic
1081343590 11:41956320-41956342 TTGAGGCCACAGCTTTGTACTGG - Intergenic
1081649454 11:44813891-44813913 TCTTGGCCCCTGCATTATGCAGG - Intronic
1081780389 11:45706670-45706692 CTTAAGCCCCAGCTTTATGCTGG + Intergenic
1084323389 11:68385774-68385796 TTCAGGCCCCAGCACCGTGCCGG - Intronic
1097803242 12:63938286-63938308 TTGAGTCCCATGAATTATGCAGG + Intronic
1102813333 12:115842697-115842719 GTGTGCCCCCAGCATCATGCTGG + Intergenic
1110819313 13:79896269-79896291 CTGAGGCTGCAGCATGATGCTGG + Intergenic
1110871009 13:80452340-80452362 TTTAGGCCCCAGAAGGATGCCGG - Intergenic
1112579790 13:100668764-100668786 TCCCGGCTCCAGCATTATGCTGG + Exonic
1119508546 14:75193259-75193281 TTGAGACCCCAGAATTGTGGAGG + Intergenic
1119704414 14:76775080-76775102 TTCAGGGCCCAGCATCAAGCCGG - Intronic
1121298504 14:92850151-92850173 TTGAGGGCCCGGCTTTCTGCTGG - Intergenic
1122379797 14:101294719-101294741 GTGAGGCCCCACAATTATGGTGG + Intergenic
1128348089 15:66867402-66867424 TTGGGATCCCAGCTTTATGCAGG - Intergenic
1133875984 16:9734960-9734982 TTGCGCACCCAGCATCATGCAGG + Intergenic
1138674666 16:58642397-58642419 TTGAGGGCCCAGCAGCAGGCAGG + Intergenic
1149396832 17:56253792-56253814 CTGAGGTCCCAGCTTTATTCAGG + Intronic
1149843654 17:59988719-59988741 TTCAGTGCCAAGCATTATGCTGG - Intergenic
1152507485 17:80760095-80760117 TTTAGGCGCCAGGAGTATGCGGG + Intronic
1152740430 17:82016221-82016243 TCGAGGCCCCAGCCTTCAGCTGG + Intronic
1156723689 18:40101778-40101800 GTGAGGACACAGCATGATGCTGG - Intergenic
1162589074 19:11578908-11578930 TGGCGGCCCCAGCTTTAAGCAGG + Exonic
1162838380 19:13336960-13336982 TTGAGAGCCCTGCATTCTGCAGG - Intronic
1163444983 19:17340878-17340900 TTGGGCCCCCAACATTCTGCCGG + Intronic
1167666344 19:50824462-50824484 TTGAGACCCCAGCATTGTTTGGG - Intergenic
932520924 2:72411475-72411497 TTGAGGTCCCATCTATATGCTGG - Intronic
933021662 2:77202029-77202051 TTAAGTCCCCGGCATTGTGCAGG + Intronic
933652023 2:84857207-84857229 TTGTTGCCCCAGCATTGTGTGGG - Intronic
933761410 2:85674783-85674805 TTCAGGCCCCAGCATGGTGCTGG + Intergenic
934187512 2:89760195-89760217 TTGAGGCTCTATCATTATGCAGG + Intergenic
934309119 2:91847744-91847766 TTGAGGCTCTATCATTATGCAGG - Intergenic
935621909 2:105137315-105137337 CTGAGGCCACAGCATTAAGGTGG + Intergenic
943738593 2:191386058-191386080 TTCAGGATCCAGCATTATGCTGG + Exonic
946148720 2:217749754-217749776 CTTAGGCCCCTTCATTATGCTGG + Intronic
1169697509 20:8407456-8407478 GGGAGGCCTCAGAATTATGCAGG + Intronic
1171017236 20:21553092-21553114 TGGAGGTGCCAGCATTATGCTGG + Intergenic
1171017239 20:21553100-21553122 CTGGGTCCCCAGCATAATGCTGG - Intergenic
1180536204 22:16394858-16394880 TTGAGGCTCTATCATTATGCAGG - Intergenic
1182675999 22:32040460-32040482 GGGAGAACCCAGCATTATGCAGG - Intergenic
1183302446 22:37064973-37064995 CTGTGGCCCCAGCATAGTGCTGG + Intergenic
1184921709 22:47609949-47609971 TTGAGGCCCCAGCACTCCCCTGG + Intergenic
951997278 3:28745033-28745055 TTTAGTCTCCAGCATTCTGCTGG + Intergenic
954094012 3:48308507-48308529 TTGAGGTCCCAACATGATACAGG + Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
955537434 3:59939220-59939242 TTGAGGCCCTTGATTTATGCTGG + Intronic
961804609 3:129480320-129480342 TTGAGGACCCAGCATTCTTTAGG - Intronic
962618749 3:137155278-137155300 CTGAGATCCCAGCATTATTCTGG - Intergenic
962846286 3:139276571-139276593 TTGAGGCCCCAGCATTATGCAGG - Intronic
963687586 3:148456435-148456457 TTGAGGGCCTAGCATTGTGCTGG + Intergenic
968486655 4:866211-866233 TTGCGGCCCAAGCATCCTGCAGG - Intronic
968974741 4:3816149-3816171 TGGAGGCACCAGCTTTATGAAGG + Intergenic
969179381 4:5425224-5425246 TTCAGGCCCAAGCAAAATGCAGG + Intronic
970778133 4:19702301-19702323 TTTAGGACCCAGCATTCTGGGGG + Intergenic
970913017 4:21300334-21300356 AGGAGGCTCCAGAATTATGCTGG - Intronic
971181367 4:24331176-24331198 TTGAGTGCACAGCATTGTGCTGG - Intergenic
977769071 4:100835617-100835639 GGGAGGCCCCAGCATCATGGCGG - Intronic
978088288 4:104682903-104682925 TTAGGGTCCCAGCATTATGTAGG - Intergenic
982371402 4:154637430-154637452 TTAATGCCCCAGCATTTTGGGGG + Intronic
984961637 4:185103111-185103133 TTGAGGGTCCAGCAATATGTAGG + Intergenic
987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG + Intergenic
991359209 5:65802589-65802611 TTTAGGCCCCACCATTCGGCAGG + Intronic
993703363 5:91143733-91143755 TTGAGGCCCCACCTTCAAGCTGG - Intronic
997007924 5:129841865-129841887 TTGAGGCCCCAGCATTACGAAGG - Intergenic
997436191 5:133877453-133877475 TTGAGGGCCCAGGGTCATGCTGG - Intergenic
997648073 5:135494337-135494359 TTTAGGCCACAGCATTGTGCTGG + Intergenic
1000574341 5:162957770-162957792 TAGAGCCTCCAGCATAATGCTGG - Intergenic
1003456939 6:6292045-6292067 TTGAGGTCCCAGCACTTTCCAGG + Intronic
1005685075 6:28246211-28246233 GTGAGGACCCAGGACTATGCAGG + Intronic
1007765169 6:44155590-44155612 TTGAGGTCCCTGCATGACGCTGG + Intergenic
1011438672 6:87365468-87365490 TTGATTCCCCAGCCTTGTGCAGG + Intronic
1017127343 6:151078589-151078611 CTGAGGGCCCAGCTTTTTGCTGG + Intronic
1018717366 6:166543920-166543942 TTAAAGTCCCAGCTTTATGCAGG + Intronic
1019800772 7:3086740-3086762 TTCACGCCCCGGCATTCTGCGGG - Intergenic
1019920544 7:4160744-4160766 TAGAGGGCCCACCATTAAGCTGG + Intronic
1020534446 7:9377535-9377557 TTGGGGCTCCAGCATAATGCTGG + Intergenic
1024714506 7:52060450-52060472 TTGTGGCCCCAGCTTAATGTTGG - Intergenic
1028314947 7:89389321-89389343 TTTAGGCCCCAGCATTTTGGGGG - Intergenic
1034990051 7:155542474-155542496 GTGAGGCCCCAGCATCAGTCAGG - Intergenic
1045434029 8:102141602-102141624 TTGAGGCCATCGCAGTATGCTGG + Intergenic
1048592138 8:135830253-135830275 TTAAGTGCCCAGCATTGTGCTGG - Intergenic
1048870201 8:138790937-138790959 CTGAGGACCCAGCATGGTGCTGG - Intronic
1049025868 8:139988451-139988473 TTGAGGACCCAGCAGCATCCGGG - Intronic
1056681417 9:88722268-88722290 TTGAGGGCACAGCATTAAGAGGG + Intergenic
1056804749 9:89719920-89719942 TTCAGGCTCCAGCTTTATGAGGG - Intergenic
1057953625 9:99389550-99389572 TCGAGGACCCATCATAATGCTGG - Intergenic
1058869499 9:109190194-109190216 CTGAGGCCCCACCACTATCCTGG - Intronic
1059985994 9:119821206-119821228 TTCAACCCCTAGCATTATGCAGG + Intergenic
1061623426 9:131826193-131826215 TTGAGGCCTTGCCATTATGCTGG - Intergenic
1185856482 X:3541113-3541135 TGGTGGCCCAAGCATAATGCAGG - Intergenic
1188980253 X:36720864-36720886 CTCAGGCCCCAGCATCAGGCTGG - Intergenic
1189082710 X:37991601-37991623 CTCAGGCCCCAGCATCAGGCTGG - Intronic
1195392083 X:104372959-104372981 TTGGGATCCCAGCTTTATGCAGG - Intergenic
1195685150 X:107578526-107578548 ATGAGCCCCCATCATTCTGCAGG - Intronic
1200112365 X:153747713-153747735 TTGGGGCTCTATCATTATGCAGG - Intergenic
1200761636 Y:7044333-7044355 CTGTGGCCCCAGCACTATGGAGG - Intronic
1200807726 Y:7449319-7449341 TGGTGGCCCAAGCATAATGCAGG + Intergenic