ID: 962849392

View in Genome Browser
Species Human (GRCh38)
Location 3:139296648-139296670
Sequence CATTCTGACCAGAGCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962849392_962849398 4 Left 962849392 3:139296648-139296670 CCCACTCTGCTCTGGTCAGAATG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 962849398 3:139296675-139296697 GGGGTTGCAGAATGAAACACAGG 0: 1
1: 0
2: 2
3: 16
4: 173
962849392_962849399 12 Left 962849392 3:139296648-139296670 CCCACTCTGCTCTGGTCAGAATG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 962849399 3:139296683-139296705 AGAATGAAACACAGGATGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962849392 Original CRISPR CATTCTGACCAGAGCAGAGT GGG (reversed) Intronic
902217305 1:14942547-14942569 GATACTGACTAGAGAAGAGTAGG - Intronic
903992297 1:27281826-27281848 CAATCTGCCCAAAGCAGATTGGG + Intronic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
906025248 1:42667977-42667999 CATGCTGCCCAGCGCAGAGCAGG - Intronic
906858389 1:49332005-49332027 CAAGCTGACCAGGGCAGAGGTGG + Intronic
911059475 1:93735191-93735213 AATTCTGACCAGGCCAGAGGGGG - Intronic
911610897 1:99958278-99958300 CATTCAGATCATAGCAGAGATGG - Intergenic
912655478 1:111482775-111482797 CCTTCTGGTCTGAGCAGAGTTGG - Intergenic
912864597 1:113245993-113246015 CATTCAAACCATAGCAGAGGTGG - Intergenic
915920863 1:159974206-159974228 CATGCTGACCAGAGAAGGGCAGG + Intergenic
917528851 1:175814995-175815017 CAAACAGACCAGAGCAGGGTTGG + Intergenic
919079621 1:192854545-192854567 GATTCTGACTAAAGCAGAGAAGG - Intergenic
919147393 1:193652797-193652819 AATTATGACCAAAGGAGAGTGGG - Intergenic
920883784 1:209904999-209905021 CATTATGACCAGAACAGCATGGG + Intergenic
922071612 1:222200315-222200337 CACTCTGACAATAGCAGACTGGG + Intergenic
922169103 1:223140205-223140227 CATTTTGAGCATAGGAGAGTAGG + Intronic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
1065875452 10:29993700-29993722 CATTCTTTCCACAGGAGAGTGGG + Intergenic
1066500875 10:35993413-35993435 CATTCTGTCAAGTGCAAAGTGGG - Intergenic
1067016560 10:42760222-42760244 CTTTGTGACCAGAGCCCAGTTGG - Intergenic
1067220790 10:44342922-44342944 CAGTCTGGGCAGTGCAGAGTAGG - Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1069598189 10:69686407-69686429 CTTTCTGGCCAGAGCTGAGCAGG + Intronic
1073471964 10:103727988-103728010 CGTTGTGAGAAGAGCAGAGTAGG + Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1073968202 10:109015551-109015573 CATTTTTTCCAGAGCAGAGGGGG + Intergenic
1074108053 10:110403243-110403265 CATTCTGAAGATGGCAGAGTAGG - Intergenic
1075655975 10:124161662-124161684 CACTAAGACCAGGGCAGAGTGGG + Intergenic
1077599189 11:3561700-3561722 CATTCTGACTTCTGCAGAGTGGG - Intergenic
1077899659 11:6478489-6478511 CATTCTCCCCAGTGCAGAGAGGG + Intronic
1080587309 11:33693703-33693725 CATAATGAACAGAGCAGTGTGGG - Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1082615409 11:55354233-55354255 CATTCTGACTACAGGAGAGATGG + Intergenic
1083890723 11:65594497-65594519 CATCCTGACTGGAGCAGAATGGG - Intronic
1084145783 11:67264673-67264695 CACTCTGCCCAAAGCAGATTAGG - Intergenic
1085158031 11:74313927-74313949 TATTCTGACCATAGAAGATTAGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088146407 11:106685678-106685700 CAGTATGAGCAGAGCAGACTGGG - Intronic
1088890765 11:114042419-114042441 CAGTCTGTCCAGAGCTGAGGAGG + Intergenic
1090884829 11:130866638-130866660 CATTCTGCCCAGAGCAACGGAGG + Intergenic
1091029552 11:132172909-132172931 CATTCTGAACAGATCAATGTAGG + Intronic
1091041567 11:132285754-132285776 AAATATGGCCAGAGCAGAGTCGG - Intronic
1091344719 11:134844954-134844976 CATTCTGAGATCAGCAGAGTGGG - Intergenic
1091684570 12:2552533-2552555 CATTCAGAACAGAGCTGAGTGGG + Intronic
1092425333 12:8371047-8371069 CATTCTGACTTCTGCAGAGTGGG - Intergenic
1094031831 12:26021304-26021326 CATTCAAACCATAGCAGAGTGGG - Intronic
1094094994 12:26693718-26693740 GATTTTGGCCTGAGCAGAGTGGG - Intronic
1094629012 12:32153921-32153943 GATGGTGACCAGACCAGAGTTGG - Intronic
1095969777 12:47893699-47893721 CTTGTTGACCAGAACAGAGTAGG - Intronic
1096772610 12:53945592-53945614 CATTCCAACCAAAGCAGGGTTGG + Exonic
1097326339 12:58281580-58281602 CACTATGACCAGAACAGCGTGGG + Intergenic
1101406325 12:104432416-104432438 CGTTATGCCTAGAGCAGAGTTGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103610947 12:122124019-122124041 CAACCTGACCAGAGCAGTGAGGG - Intronic
1103945511 12:124524073-124524095 CATTCTACCCAGATCACAGTGGG + Intronic
1106382647 13:29255210-29255232 TGTTCTGAGCAGAGCAGAGACGG + Intronic
1106827946 13:33544593-33544615 CATTCAGGCTAGAGCAGAGAGGG - Intergenic
1107734838 13:43388066-43388088 TATTCTGAAAATAGCAGAGTTGG + Intronic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1113525454 13:110971407-110971429 CATTCAAACCACAGCAGAGAAGG + Intergenic
1113531373 13:111029976-111029998 AATTCTGGCCAGAGCCCAGTGGG + Intergenic
1117359571 14:54959736-54959758 CACTCAGACTGGAGCAGAGTTGG - Intronic
1117935615 14:60902683-60902705 CAATCTGATCAGAGAAGAATGGG + Intronic
1118318530 14:64739907-64739929 CATTCAGAGCAGAGCAAATTGGG + Intronic
1119181392 14:72607554-72607576 CATTCATACCATAGCAGACTAGG + Intergenic
1119499281 14:75109709-75109731 CACTGTGACCACAGCAAAGTGGG + Exonic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1126981493 15:54249346-54249368 CATTTTAAGCAGAGCAGAGGAGG + Intronic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1128045390 15:64613410-64613432 CATTCTGACAAGAGCTTTGTGGG + Intronic
1128372912 15:67053630-67053652 AAGTCTGAACAGGGCAGAGTGGG + Intergenic
1128622262 15:69160744-69160766 CTTTCTAACCTGAGCAGCGTCGG - Exonic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1131164340 15:90131431-90131453 CATTTTGCCCAGAACAGAGCAGG + Intergenic
1131564570 15:93474339-93474361 CATTTTGAATTGAGCAGAGTTGG - Intergenic
1133047368 16:3096208-3096230 TTTTCTGAGCAGAGCAGAGCAGG + Intronic
1134036066 16:11032364-11032386 CATTCTGAGAGGTGCAGAGTGGG - Intronic
1135056688 16:19237868-19237890 CACTATGGCCAGAGCAGGGTTGG + Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137602836 16:49768312-49768334 CATTCTGGGCCGAGAAGAGTTGG - Intronic
1138700672 16:58859607-58859629 GAAGCTGAACAGAGCAGAGTAGG - Intergenic
1141092507 16:81139777-81139799 CATGCTGATCAGAGTAGAGTGGG - Intergenic
1142183345 16:88682301-88682323 CATTCAGAGCACAGTAGAGTGGG - Intronic
1143418072 17:6764829-6764851 GATTTTGACAAGAGCAGATTTGG - Intronic
1144792986 17:17871960-17871982 CATTCACAACAGAGGAGAGTGGG - Intronic
1149655121 17:58305857-58305879 CATTCTTTCCACAGCTGAGTCGG - Exonic
1151431045 17:74063500-74063522 CGTTCTGTCCAGAGCTGAGTGGG + Intergenic
1152128303 17:78460633-78460655 CATTCTGACCTGAGCGTTGTGGG - Intronic
1152930739 17:83108223-83108245 CTGGCTGACCAGAGCAGAGAAGG + Intergenic
1153132589 18:1873602-1873624 CATTCTGACTAGAACAGATAAGG - Intergenic
1154053538 18:10987993-10988015 CATTCAGACCACAGCAGAGGTGG - Intronic
1154123786 18:11672296-11672318 CATGCTGACCAAAGCAGTGCCGG + Intergenic
1157479695 18:48045433-48045455 CTTTCTGAGCACAGCTGAGTGGG + Intronic
1158565933 18:58554291-58554313 CAGTCTGCCCAGCACAGAGTTGG + Intronic
1159457269 18:68676151-68676173 TATTCTGGCTAAAGCAGAGTAGG + Exonic
1160177607 18:76608654-76608676 CTGTCTGAACAGAGCAGAGGTGG - Intergenic
1165558697 19:36659300-36659322 CAATCTGAGCAGAGCTCAGTAGG - Intronic
1166219644 19:41356158-41356180 GGTTCTGAGCAGAGCAGAGATGG + Intronic
1167805449 19:51780614-51780636 CAATCTGCCCACAGCAGAGATGG + Intronic
1168427689 19:56252440-56252462 ATTTCTGAAGAGAGCAGAGTGGG + Intronic
924968509 2:100953-100975 CATTCTGACCAGGATGGAGTTGG - Intergenic
926319938 2:11742750-11742772 CAATCTGACCAGAGGAGAAAGGG + Intronic
932824319 2:74925853-74925875 TATTCTGGCCAAAACAGAGTTGG + Intergenic
934149015 2:89127403-89127425 GATGCTGACCAGAGCAGTGCAGG - Intergenic
934218279 2:90054643-90054665 GATGCTGACCAGAGCAGTGCAGG + Intergenic
937865285 2:126746505-126746527 CAGTCTTTCCATAGCAGAGTGGG - Intergenic
938850579 2:135255475-135255497 TAAGCTGAGCAGAGCAGAGTGGG - Intronic
940569737 2:155416410-155416432 CATTCTGACCTCAGCAGAGAAGG - Intergenic
940791929 2:158038045-158038067 CATTCTAATCAGAGCAGAAATGG - Intronic
944330145 2:198456064-198456086 CATTCTCAGAAGAGCAGAGAAGG + Intronic
944976541 2:205059525-205059547 AATTCTGTCCAGAGCAGAAAGGG - Intronic
946152586 2:217786262-217786284 CATTGAGATCAGAGAAGAGTGGG - Intergenic
946710927 2:222504461-222504483 CATTCTGAGCACAGCAGCATTGG + Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947288662 2:228546740-228546762 CATTTAGACCATAGCAGAGAGGG + Intergenic
947360753 2:229343111-229343133 CATTCAGGCCAGCTCAGAGTAGG - Intergenic
948264324 2:236626239-236626261 GATTCTGAACAGTGGAGAGTTGG - Intergenic
948280688 2:236745627-236745649 CATTCTGTCCAGAGCAGGAGTGG - Intergenic
948810395 2:240472337-240472359 CCTTCAGACCATGGCAGAGTGGG - Intergenic
1169094791 20:2887768-2887790 CACTGTTACCAGAGCAGTGTGGG + Intronic
1169210935 20:3765976-3765998 CATGCTGACCAGAGGTGAATGGG - Intronic
1169256123 20:4100595-4100617 CAATCTGACAAGTCCAGAGTAGG + Intergenic
1170389356 20:15854928-15854950 CAGTCTCACCAGTGCAGGGTTGG - Intronic
1172303203 20:33863987-33864009 CATCCTGACCAAAGCAAAGCCGG - Intergenic
1173655109 20:44694794-44694816 GATTCTGACCAGAGCCTGGTGGG + Intergenic
1173905939 20:46628802-46628824 CATTCTGAACAGAGCAGATATGG + Intronic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1177911167 21:27034079-27034101 TAGTCTGACCAGAGCATTGTAGG - Intergenic
1179823402 21:43950575-43950597 CATTCGGACGAGATCAGCGTGGG + Intronic
1181417296 22:22769921-22769943 CATTCTTGCCAGGACAGAGTGGG + Intronic
1183078192 22:35439869-35439891 CATGGTGCCCAAAGCAGAGTGGG + Intergenic
1184387967 22:44186981-44187003 CCTTTTGAGCACAGCAGAGTGGG + Intronic
1184773309 22:46610451-46610473 CATTTGCACCACAGCAGAGTTGG + Intronic
949852342 3:8431796-8431818 CAGACTGACCAGAGGAGATTAGG + Intergenic
950004072 3:9680137-9680159 CAAGCTGTCCAGAGTAGAGTTGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951092455 3:18590083-18590105 CATTCTGTGAACAGCAGAGTTGG + Intergenic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
953207000 3:40839917-40839939 CATTCAGACCATAGTACAGTGGG + Intergenic
955519605 3:59762168-59762190 CATCCTGGCCAGGACAGAGTGGG + Intronic
955550273 3:60076965-60076987 TATTCTGAGCAAAGGAGAGTTGG + Intronic
956322844 3:68017887-68017909 CATTCTGAGCAGAGAAGATTTGG + Intronic
956385758 3:68717324-68717346 TATTCTGACCAGAGCCTGGTAGG + Intergenic
960240532 3:115336316-115336338 CATACTGCCCAGAACATAGTAGG - Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
963412708 3:144951926-144951948 CAGTCAGACATGAGCAGAGTGGG - Intergenic
963905695 3:150771939-150771961 AATTCTGACAAGAGCAGTTTGGG + Intergenic
963907758 3:150787051-150787073 CATTCTGACAAGGGCAGGGTGGG + Intergenic
965547490 3:169931272-169931294 CTTTCTCACCAGAGCAGTTTGGG - Intronic
965811634 3:172596944-172596966 CATTCTGACCTAAAGAGAGTAGG + Intergenic
967968433 3:194982242-194982264 CATTCAAACCAGAGCAGGCTGGG + Intergenic
968384615 4:124989-125011 CATTCTGAACAGGGTAAAGTAGG - Exonic
968437389 4:600991-601013 ATTTCTGGCCAGAGCAAAGTTGG - Intergenic
969132446 4:5001849-5001871 CAATCTGACCTTAGCAGAGCTGG + Intergenic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
972334385 4:38094214-38094236 CATTGTTAACAGAGCAGAATTGG + Intronic
974057378 4:56997637-56997659 CATTCTTATTAGAGGAGAGTGGG + Intronic
974205879 4:58702816-58702838 CATTGTCACAAGAGCAGAATGGG + Intergenic
976501716 4:85797818-85797840 CATTCTGAGGAGGGCAGGGTTGG - Intronic
976871491 4:89799365-89799387 CATTGTCACCAGAGCATAGCAGG - Intronic
977838275 4:101670935-101670957 CATTCTGGCCAGAGCAAAATGGG - Intronic
978237664 4:106478987-106479009 CATTCAAACCACAGCAGAGATGG - Intergenic
978696584 4:111587362-111587384 CATCCAGACCAGAGCAGACAGGG + Intergenic
980342333 4:131566780-131566802 CATTCTGACAATAGGAAAGTTGG + Intergenic
980486384 4:133462372-133462394 CTTTCTGAACAGAGCAGGGTGGG - Intergenic
982027442 4:151264837-151264859 GATGCTGACCAGAGCTGAGTTGG + Intronic
982097739 4:151938104-151938126 TAATCTGAGCAGAGCAGACTGGG + Intergenic
983102653 4:163644581-163644603 CTCTCTGACCATAGCAGAGGGGG - Intronic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
989624663 5:43417745-43417767 CATTTTGCCCAGTGCAGAGATGG - Intergenic
999442988 5:151616891-151616913 ACTTCTGACCAGGGCAGAGGGGG - Intergenic
999717523 5:154373334-154373356 CATTCTACCCAGAGAAGAGCAGG - Intronic
1000406539 5:160893685-160893707 CAGTCTGTCCTGAGCAGAGCTGG - Intergenic
1002095112 5:176826042-176826064 CCCTGTGACCAGACCAGAGTAGG - Intronic
1003967586 6:11267944-11267966 GATTTAGACCACAGCAGAGTTGG + Intronic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1009911870 6:69939768-69939790 CCCTCTAACCAGAGAAGAGTTGG - Intronic
1013270673 6:108542933-108542955 CATTCTGACCTGAATAGACTTGG + Intergenic
1013658956 6:112275073-112275095 CATTCTCAGAAGAGCAGAGCTGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014509365 6:122302096-122302118 CATTCTGTCCAGTGGACAGTGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017781292 6:157717412-157717434 CACTCTGACCCGAGCAGGGCGGG - Intronic
1018633889 6:165843716-165843738 CATTCAGGCCACAGCAGAGAGGG + Intronic
1022494279 7:30843553-30843575 CCTTGTGCCCTGAGCAGAGTCGG - Intronic
1023046400 7:36214163-36214185 GATTCTGTCCAGAGCACAGGTGG + Intronic
1024973494 7:55092146-55092168 CATTCTGTCCTGAGCAGAGCAGG - Intronic
1025191307 7:56897867-56897889 CATTCTGACAACAGAACAGTGGG - Intergenic
1025680639 7:63679067-63679089 CATTCTGACAACAGAACAGTGGG + Intergenic
1026375513 7:69746650-69746672 CAGCCTGACTAGAGCAGAGAGGG + Intronic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1032688607 7:134259987-134260009 CCATCTGGCCAGAGCAAAGTGGG + Intronic
1034102181 7:148459315-148459337 CATCCTGACCAGAGGAGGGCAGG + Intergenic
1034749424 7:153554890-153554912 CATTTTGGCCAGTGCAGGGTTGG + Intergenic
1038009361 8:23462470-23462492 CATTCAGACCACAGCAGGGAGGG - Intergenic
1038950330 8:32407411-32407433 CATTTTGACAAGAACAGTGTAGG + Intronic
1040360503 8:46659753-46659775 CATTGTTACCACAGCATAGTTGG - Intergenic
1040603672 8:48909534-48909556 CATTCTGAGAATAACAGAGTGGG - Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042519961 8:69701042-69701064 CATTGTGTCCAGATGAGAGTAGG + Intronic
1044323597 8:90834295-90834317 CATTCAGACCATAGCAGTGGGGG - Intronic
1047435585 8:124833250-124833272 TCTTCTGACCAGTGCAGAATAGG - Intergenic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1050436037 9:5611870-5611892 CATTGTCATCAGTGCAGAGTGGG - Intergenic
1051108866 9:13612040-13612062 CATTCAGACCATAGCATATTGGG + Intergenic
1053603990 9:39638542-39638564 CACTTTGACAAGAGCAGTGTAGG + Intergenic
1053861802 9:42394589-42394611 CACTTTGACAAGAGCAGTGTAGG + Intergenic
1054249550 9:62703872-62703894 CACTTTGACAAGAGCAGTGTAGG - Intergenic
1054563661 9:66738404-66738426 CACTTTGACAAGAGCAGTGTAGG - Intergenic
1055141546 9:72882310-72882332 CCCTCTGAACAGAGCAGGGTAGG - Intergenic
1055545042 9:77361755-77361777 CATTCTTACCAGAGCATATGAGG + Intronic
1057861742 9:98646161-98646183 CATTCTTATCAGAGGGGAGTGGG - Intronic
1059463092 9:114447614-114447636 CATTCAAACCACAGCACAGTTGG - Intronic
1059600390 9:115770964-115770986 TAATGTGACCAAAGCAGAGTAGG + Intergenic
1059741587 9:117155982-117156004 TATTATTAACAGAGCAGAGTAGG + Intronic
1061089473 9:128418965-128418987 CATTCTGACCATAGCACCCTTGG + Intronic
1203495921 Un_GL000224v1:151413-151435 CATTCAGACCAGAGCAGGAGTGG + Intergenic
1203508545 Un_KI270741v1:93336-93358 CATTCAGACCAGAGCAGGAGTGG + Intergenic
1189064913 X:37797094-37797116 CACTCTGCCCAGAGCCCAGTTGG + Intronic
1191007385 X:55724005-55724027 GAGTCTGATCAGGGCAGAGTGGG + Intronic
1192302084 X:69915649-69915671 CAAAGTGACCAGTGCAGAGTAGG - Intronic
1192707080 X:73537809-73537831 CTTCCAGACCACAGCAGAGTGGG - Intergenic
1193162205 X:78240750-78240772 CACTCCTACCAGGGCAGAGTGGG - Intergenic
1197136041 X:123060742-123060764 GATTGTGACCAGTGCAGAGATGG - Intergenic
1198214653 X:134545241-134545263 CATTCAGACCAGAGGAGTTTGGG + Intergenic
1198666768 X:139032750-139032772 CATTCAGACCCCAGCAGAGCAGG - Intronic