ID: 962850572

View in Genome Browser
Species Human (GRCh38)
Location 3:139305731-139305753
Sequence ATGCCTTTCTTGCAGGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962850563_962850572 14 Left 962850563 3:139305694-139305716 CCAAAGATAGCCATGCCCTATGT 0: 1
1: 0
2: 0
3: 10
4: 145
Right 962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG 0: 1
1: 0
2: 0
3: 20
4: 242
962850565_962850572 -1 Left 962850565 3:139305709-139305731 CCCTATGTTTATCTCACCCCATA 0: 1
1: 0
2: 1
3: 8
4: 209
Right 962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG 0: 1
1: 0
2: 0
3: 20
4: 242
962850566_962850572 -2 Left 962850566 3:139305710-139305732 CCTATGTTTATCTCACCCCATAT 0: 1
1: 0
2: 1
3: 10
4: 173
Right 962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG 0: 1
1: 0
2: 0
3: 20
4: 242
962850564_962850572 4 Left 962850564 3:139305704-139305726 CCATGCCCTATGTTTATCTCACC 0: 1
1: 0
2: 0
3: 17
4: 145
Right 962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG 0: 1
1: 0
2: 0
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962850572 Original CRISPR ATGCCTTTCTTGCAGGGTGA CGG Intronic
901379413 1:8862991-8863013 AGGCATTTCTGGCAGGGAGAGGG + Intronic
902789007 1:18752371-18752393 ATGCCTATCTTGCAGGATATTGG - Intergenic
903237035 1:21956834-21956856 ATGCCCTTCGGGCAGGGTGGAGG - Intergenic
903971650 1:27122787-27122809 GTGCCTTTCCTGCAGGGGGAGGG - Intronic
904928483 1:34067025-34067047 GTGCCTTCCCTGCAGGCTGAGGG - Intronic
905494034 1:38370428-38370450 ATTCCTTTCTTGCCAGGGGAGGG + Intergenic
907906691 1:58788764-58788786 ATGCCTTACTTAAAGGGTGCAGG + Intergenic
908822843 1:68105687-68105709 ATGTATTTCTTGGAAGGTGAGGG + Intronic
912609106 1:111025098-111025120 TTGGCGTTCCTGCAGGGTGATGG - Intergenic
914923661 1:151865028-151865050 CTGTCTTTCTTCCATGGTGATGG + Intergenic
917292467 1:173485268-173485290 TTTCCTGTCTTGCAAGGTGATGG + Intronic
917577583 1:176340147-176340169 ATGACTCCCTTGCAGGGAGATGG + Intergenic
917689234 1:177450323-177450345 ATGCTTTTCTTTTAGGTTGAAGG - Intergenic
917747864 1:178028042-178028064 ATGGCTTTCTCCTAGGGTGATGG - Intergenic
918700077 1:187597372-187597394 ATGAATGTCTTCCAGGGTGAGGG - Intergenic
920255678 1:204652537-204652559 ATGCCTACTTTGCAGGGTGGTGG + Intronic
920433164 1:205931824-205931846 ATGCCCTTCTAGCAGGGTTGGGG + Intronic
920441906 1:205986325-205986347 ATGCCTATCTCACAGGGTCATGG - Intronic
920830758 1:209463593-209463615 ATGCCCATCTTGCTGAGTGATGG - Intergenic
921792865 1:219309672-219309694 AGGCATTTCTTACATGGTGAAGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923299374 1:232627506-232627528 ATCCCAGTCTTGCGGGGTGAGGG + Intergenic
923315249 1:232773683-232773705 TTGCCTTTTTTGCAGGGACAGGG - Intergenic
923410066 1:233699348-233699370 CTTCCTTTCTTCCAGGGTGTGGG - Intergenic
923749459 1:236734164-236734186 GTGCCTTTCTTGCTAGGTTAGGG + Intronic
924162919 1:241252464-241252486 ATGTATTTGTTGCAGGGTGTGGG - Intronic
1062818089 10:516000-516022 ATTCCTTGCTTTCGGGGTGAAGG + Intronic
1063678338 10:8162010-8162032 ATGCCTTTCTCGGCGGGAGAAGG - Intergenic
1066244774 10:33571744-33571766 AAGCTTTTCTTGCAGGGAGGTGG - Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1068813454 10:61282863-61282885 CAGCCTTTCTTGCATGGTCATGG - Intergenic
1071828666 10:89350619-89350641 AAGCATTTCTTGCAGGGGGTTGG + Intronic
1071986657 10:91058432-91058454 ATGCCTGTCTTATAGGATGAGGG + Intergenic
1073489574 10:103844117-103844139 ATGCTTCTCTTGCAGAGTTAAGG - Intronic
1073706214 10:105987312-105987334 ATGCCTACCTTTCAGGATGAAGG + Intergenic
1074178125 10:111031951-111031973 AGGCATTTCTTACATGGTGACGG + Intergenic
1075541779 10:123319588-123319610 ATGCCTTTTTTACAGCATGATGG - Intergenic
1076907348 10:133369663-133369685 AAGCCTCTCTTCCAGGGTGGGGG - Intronic
1077344142 11:2038691-2038713 GTGCCCTCCTTGCAGGGTGGTGG - Intergenic
1077974285 11:7231670-7231692 ATGCCTTTTCTTCAGAGTGATGG - Intergenic
1078001961 11:7504106-7504128 TTGCCTTTTTTATAGGGTGACGG + Intronic
1078065779 11:8078408-8078430 ATGCCCTTCTTCGAGGGTCATGG + Intronic
1081582744 11:44363601-44363623 GTACCTTCCTTGCAGCGTGATGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086077648 11:82871599-82871621 TTGCCTTTTTTGGAGGTTGAGGG - Intronic
1088841427 11:113630555-113630577 ATGCCTTTCCTACAGGGACAAGG + Intergenic
1090427368 11:126617701-126617723 ATGCCTATCTTGCTGGGTTGTGG - Intronic
1090709001 11:129369255-129369277 AATCCTGTCTTGCCGGGTGAGGG + Intergenic
1202827128 11_KI270721v1_random:93880-93902 GTGCCCTCCTTGCAGGGTGGTGG - Intergenic
1092049180 12:5455830-5455852 GTGCCTTTCATGGATGGTGAGGG + Intronic
1092173873 12:6390097-6390119 ATCTCTTTCCTGCAGGGAGAGGG + Exonic
1092547911 12:9467637-9467659 ATGCCTTACTTGCTGAGGGAAGG + Intergenic
1094474518 12:30831122-30831144 ATGCCTTACTTGCTGAGGGAAGG - Intergenic
1097566898 12:61281591-61281613 AGGCCTATCTTGAAGGTTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098112821 12:67141605-67141627 ATGCCTTTTCTGCAGGAGGAGGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098818630 12:75201719-75201741 TTGCCTTCCGTGCAGGTTGAGGG - Intronic
1099488830 12:83262051-83262073 AGTCCCTTCTTGAAGGGTGATGG + Intergenic
1101443229 12:104719076-104719098 TTCCCTCTCTTGCTGGGTGAGGG + Intronic
1102947937 12:117006356-117006378 ATCCATTTCTTACTGGGTGAAGG + Intronic
1102982185 12:117250674-117250696 ACCCTTTTCTTGCAGGGTGGCGG + Intronic
1103575330 12:121873220-121873242 AGGCCTTCCTTGAAGGGTTATGG - Intergenic
1103743332 12:123106020-123106042 ATACCATGCTTGCAGGGGGATGG - Intronic
1103774253 12:123354470-123354492 GTTCTTTTTTTGCAGGGTGAAGG + Intronic
1104755536 12:131266925-131266947 ATGCCTTCTGAGCAGGGTGATGG + Intergenic
1105540774 13:21314586-21314608 ATCTCTTTCTTGCACGGGGAGGG - Intergenic
1105631676 13:22175745-22175767 ATTTCTTTCTTGGAAGGTGAAGG - Intergenic
1107396616 13:40024720-40024742 ATTTCTTTCTTGCACTGTGAAGG - Intergenic
1107985823 13:45775473-45775495 AAGCCTTGCCTACAGGGTGAGGG - Intergenic
1108889981 13:55245091-55245113 ATTCCTTTCTGGCATGGTGTGGG - Intergenic
1110744612 13:79038007-79038029 ATCTCTCTCTTTCAGGGTGAAGG - Intergenic
1110815208 13:79853340-79853362 ATCCCTTTCTTGCAGAGTATAGG - Intergenic
1112143188 13:96669360-96669382 ATGTCTTTCCTGGAGGGAGAAGG - Intronic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116688519 14:48074310-48074332 GTGCTGTTCTTGCAGAGTGATGG - Intergenic
1117228420 14:53688149-53688171 ATCCCTTTCTTGCAGAATGAAGG - Intergenic
1117845344 14:59905860-59905882 ATGCCTTCCCTGCATGGGGAAGG + Intergenic
1118105579 14:62655523-62655545 ATGCCTTTTTTGGAGGGCGGGGG + Intergenic
1118823598 14:69361160-69361182 ATGCCTGTCCTGCAGGCTGGAGG - Intergenic
1119024634 14:71142858-71142880 ATGCCTTCCTTGCTGGGTTTTGG + Intergenic
1119354074 14:73990677-73990699 ATGGCTTTGTTGCAGAATGATGG - Intronic
1119780398 14:77273205-77273227 AGGCCTTTCTTGAAGGGAGCAGG - Intergenic
1119917401 14:78414633-78414655 ATTCCCATCTTGCAGGGTCATGG - Intronic
1120060210 14:79973800-79973822 ATGTCTTTGTGGCAGGGTTATGG + Intergenic
1121132846 14:91464330-91464352 ATGCTTTTTTTGGGGGGTGAGGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1126864199 15:52920000-52920022 ATGCTTTTTTTGCAGGGCCAGGG + Intergenic
1129616753 15:77104931-77104953 ATGCTCCTCTTCCAGGGTGAAGG - Exonic
1129677828 15:77642013-77642035 ATGCCTATCTTGGAGGGTTGTGG + Intronic
1130656693 15:85796184-85796206 AAACCTTTCTTGCAGGGGTATGG + Intergenic
1131079408 15:89522362-89522384 ATGTCATTCTTGCAGGATCATGG - Intergenic
1132463508 16:67093-67115 ATTCCTTACCAGCAGGGTGATGG - Intronic
1132892699 16:2212083-2212105 ATGCCTCTCTTGCCGGGTAGGGG - Exonic
1134136516 16:11680082-11680104 TTGTCTTTCTTGGAGGGTGTGGG - Intronic
1134380379 16:13718862-13718884 ATCTCTTTCTTGCAGGGCTAAGG - Intergenic
1135207954 16:20499032-20499054 ATGCCCTTCTTGCAGTGGCAGGG - Intergenic
1135210945 16:20524668-20524690 ATGCCCTTCTTGCAGTGGCAGGG + Intergenic
1137686646 16:50391294-50391316 CTGCCTTTCATGCAAGGGGAAGG - Intergenic
1137983242 16:53087271-53087293 GTGCTTTTCTTCCAGGGAGAGGG + Intronic
1138568583 16:57852243-57852265 AGGACTTTGCTGCAGGGTGATGG + Intronic
1139009736 16:62617211-62617233 AAACCACTCTTGCAGGGTGATGG - Intergenic
1139134055 16:64179874-64179896 TGGCCTTTCTTGCAGGAGGAAGG - Intergenic
1139287618 16:65829677-65829699 ATTCCTTTCTTGCAGGCTTAGGG + Intergenic
1140288259 16:73625470-73625492 ATGGATATCTTGCAGGATGACGG - Intergenic
1141312482 16:82928022-82928044 ATGCTTTTCATGCATTGTGATGG + Intronic
1142329382 16:89441415-89441437 CTGCTTTTGTTGCTGGGTGATGG - Intronic
1143065324 17:4242757-4242779 ATGGCTTTGTTTCAGGGTGCTGG + Intronic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1149017208 17:51922156-51922178 CTACCTTCCTTGCAGGGTGGTGG - Intronic
1151579118 17:74968276-74968298 ATGCCTTACTGGCAAGGTCAGGG - Intronic
1153175880 18:2372448-2372470 ATGCCATTCTTGCAGGAGTAAGG + Intergenic
1155073902 18:22338777-22338799 ATCCATATCTTGCAGGATGAGGG + Intergenic
1157364617 18:47053133-47053155 ACTCCTTTGGTGCAGGGTGAGGG - Intronic
1157742079 18:50102575-50102597 ATACCTCTGATGCAGGGTGAAGG + Intronic
1158806514 18:60980160-60980182 ATGGCTTTCTTCCAGTGTGAGGG + Intergenic
1159642557 18:70880715-70880737 ATTCCTATCTCCCAGGGTGACGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1161565715 19:5000943-5000965 ATTCCTTTCCTGCAGGGGGTGGG - Intronic
1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG + Intergenic
1163315474 19:16537863-16537885 AAACCTTTCTAGCAGCGTGATGG + Intronic
1164800609 19:31073264-31073286 ATACCTCTGTTGCAGGGTGTGGG + Intergenic
925669706 2:6297789-6297811 TTGTCTTTCTTCCAGGGGGAGGG - Intergenic
928567167 2:32564791-32564813 CTGCCTTCCTAGCGGGGTGAGGG - Intronic
929267303 2:39932050-39932072 AAACCTTGCTTGCAGAGTGATGG + Intergenic
931495390 2:62800846-62800868 AAGCCTTTCATGAAGGGTGATGG - Intronic
933402660 2:81818827-81818849 GAGCCTTTCTTGCAGGGGCAGGG + Intergenic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
935769652 2:106405347-106405369 ATGCCTTTTTTGTTGGGTGGGGG + Intronic
936058439 2:109279026-109279048 TTATCTTTCTTCCAGGGTGATGG + Intronic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
937069399 2:119051160-119051182 ATTCCTTTTTTGCAGGATCAAGG - Intergenic
937108090 2:119337874-119337896 ATGTCTTTTTTCCAGGGTCACGG - Intronic
937475436 2:122211007-122211029 ATTCCTGTCTTGCAGGATGATGG - Intergenic
938122474 2:128643724-128643746 ATACCTTCCTTGTAGGGTCATGG + Intergenic
938203502 2:129397443-129397465 ATGGCTTTCTTGAAGGAAGAGGG + Intergenic
939114032 2:138040192-138040214 ATACCTATCTTCCCGGGTGATGG + Intergenic
939595352 2:144116222-144116244 TTGCCTTACTTGCTGGGTTAAGG - Intronic
940879698 2:158934542-158934564 ATGGATTTATTGCAGGATGAGGG + Intergenic
942966598 2:181901370-181901392 ATACCTAATTTGCAGGGTGAGGG - Intronic
945180969 2:207090793-207090815 ATGTCTCTCCTGCAGGGTGCTGG - Intronic
945298888 2:208197721-208197743 ATCCCTTTCCTCCAGGGAGAAGG + Intergenic
948858561 2:240742010-240742032 AGGTCTTTCTTGCAGGCTGTGGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1174618261 20:51853405-51853427 ATGCCGTCTTTGCAGGGTGTGGG + Intergenic
1178135600 21:29623411-29623433 AAGCCTGTCTTGCAGGGTTTGGG - Intronic
1178730328 21:35096170-35096192 ATGCTTATGTTGAAGGGTGAGGG - Intronic
1179464313 21:41561569-41561591 TTGCCTGACTTGCAGGGGGATGG + Intergenic
1180201057 21:46224488-46224510 CTGCCCTTCTTCCAGGGTGTAGG - Intronic
1180724699 22:17937981-17938003 ATCCCTTTCTTGCAAGGAGGAGG + Intronic
1181395559 22:22618718-22618740 ATGACCTTGCTGCAGGGTGAGGG + Intergenic
1182195920 22:28517503-28517525 ATTCCTTTTTTTGAGGGTGAAGG - Intronic
1184522942 22:45006942-45006964 ATGCCATTTTTGGAGGGGGAGGG - Intronic
949639390 3:6018147-6018169 AGGTCTTTCTTCCAGGGTCATGG + Intergenic
950917467 3:16660548-16660570 ATGGCTTGCTTGCGGGGAGAGGG - Intronic
951122447 3:18944466-18944488 ATCCCTGTCTGGTAGGGTGAGGG + Intergenic
951688860 3:25374459-25374481 ATGCCTAGCTTGAAGGGTGAAGG + Intronic
953998113 3:47536209-47536231 AGGCCTTTATGGCAGGGTGAGGG + Intergenic
955485095 3:59427057-59427079 TTGCCCTTATTGCAGGGAGACGG + Intergenic
955596845 3:60600435-60600457 ATTAGTTTCTTGCAGGGTGGAGG - Intronic
955879688 3:63530254-63530276 CTGCCTTTTTTGTAGGGTGAGGG + Intronic
957179878 3:76862675-76862697 ATGACTTGCTTCCAGGGAGAAGG + Intronic
957660418 3:83144620-83144642 GTGCCTTCCTTGGAGGGTGTTGG + Intergenic
959630749 3:108504798-108504820 ATGCCTTGGTGGCAGGGAGAAGG + Intronic
959902403 3:111675109-111675131 ATGCCTTTCTGGCTGGGGGACGG - Exonic
960124523 3:113983982-113984004 ATGCTTTTCTGGCAGGGTCATGG + Intronic
961413551 3:126741206-126741228 CTGCCTTACCTGCAAGGTGAGGG + Intronic
961607058 3:128104010-128104032 TTGCCTGTCTTTCAGGGTTATGG - Intronic
961946898 3:130700798-130700820 ATGCCTTTATTGACTGGTGAGGG - Intronic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG + Intronic
965013822 3:163130715-163130737 TGGCCATTCTTGCAGGATGAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
967806643 3:193719956-193719978 AAACCTGCCTTGCAGGGTGATGG - Intergenic
968869782 4:3235908-3235930 GAGCCTTTCTTGCAAGGTGATGG - Intronic
969310314 4:6349140-6349162 GGGCCTTTCTGTCAGGGTGATGG - Intronic
969400996 4:6955399-6955421 ATACCTTTCTTGTAGGGTCATGG + Intronic
971812472 4:31444516-31444538 CTGGCTCTCTGGCAGGGTGAGGG + Intergenic
974053910 4:56966587-56966609 ATGCCTTGATTGCATGGTTATGG - Intronic
975478073 4:74845394-74845416 ATGCTTTCCTTTCAGGGTAAAGG + Intergenic
977921045 4:102642784-102642806 ATCCCTTTCCTCCAGAGTGATGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979923363 4:126528140-126528162 AAGCATTTATTGAAGGGTGAAGG - Intergenic
982790428 4:159585732-159585754 CTTCCTTTCTTCCAGGGGGAGGG - Intergenic
988644489 5:33079177-33079199 AAGCTTTTTTTGCAGGGGGATGG - Intergenic
991442079 5:66661333-66661355 CTGCCTTCCATGCAGGATGAAGG + Intronic
994897015 5:105719748-105719770 TTGCCATTCTTGCAGGATTAAGG - Intergenic
995718714 5:115106579-115106601 ATGCCATTCTTGCAGGAGTAAGG - Intergenic
996140927 5:119907966-119907988 ATGCCATTCTTGCAGGAGAAAGG + Intergenic
996500465 5:124210635-124210657 ATGCCATGCTTGGAGAGTGAGGG + Intergenic
998011049 5:138695948-138695970 ATGTCTGTTTGGCAGGGTGAGGG - Intronic
1001083027 5:168680722-168680744 ATGGCTTCCATGCAGGCTGATGG + Intronic
1001448561 5:171806659-171806681 ATTCATTTCATGCAGGTTGAGGG - Intergenic
1003412124 6:5874764-5874786 ATCTCTTTCTTGCAGGGGGAGGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007230192 6:40342870-40342892 AGGCCTTCCTGGCAGTGTGAGGG - Intergenic
1007493573 6:42243525-42243547 CTACCTGTGTTGCAGGGTGAGGG - Intronic
1007658173 6:43465441-43465463 ATGCCTGTCTGGCAGAGTTATGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012450104 6:99346282-99346304 GTGCCTTTCTTGCAGCGTCTAGG - Intronic
1013450239 6:110273679-110273701 TTGCCATTCTTGCAGGGGTAAGG - Intronic
1013781402 6:113732599-113732621 CTGCTTTTGTTGGAGGGTGAGGG - Intergenic
1013815754 6:114095413-114095435 ATGCCTTTCTTCAGGGCTGATGG + Intronic
1015368821 6:132427431-132427453 ATGCCTTACTCGCAGGAAGATGG + Intergenic
1017772550 6:157654200-157654222 ATGCTTTGCTTGCAGTGTGTAGG + Intronic
1018520209 6:164641010-164641032 TTTCCTTCCTTGCAGGGAGAAGG + Intergenic
1019733186 7:2638492-2638514 AGGCCATTCCTGGAGGGTGAGGG + Intronic
1022393743 7:29966352-29966374 GTGCCCTTCTTCCAGTGTGAAGG - Intronic
1023087577 7:36586845-36586867 ATGCCATTCTTGGAGGGTTTTGG - Intronic
1024238187 7:47413990-47414012 GTGCCTTTCTTTCAGTGTGCCGG - Exonic
1024371321 7:48587139-48587161 ATGCCTCTCTTCCAGGTTGCTGG + Exonic
1024684582 7:51731252-51731274 ATGCCTCTCTTGCAGAGTAGTGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1030480427 7:110096880-110096902 ATGTCATTCTTGCAGGGGTAGGG + Intergenic
1031935544 7:127731935-127731957 ATGCACTTCTTACTGGGTGATGG - Intronic
1032791157 7:135243329-135243351 ATGCCCATCTTCCAGGTTGAAGG - Exonic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033753726 7:144380117-144380139 AGGCCTCTCTTGCAGGGTTCTGG - Exonic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034907121 7:154959541-154959563 AGGCCATTCTTGAAGTGTGAGGG - Intronic
1036750093 8:11438248-11438270 CTGGCTGTCTTGCAGGGTCAAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041386742 8:57312323-57312345 ATGACTTTCTTGCTGGGTTTTGG + Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1046301673 8:112301730-112301752 ATGCCTCTTTTCAAGGGTGAGGG + Intronic
1047970865 8:130083299-130083321 AGGCCTTCCTTGCAGGGAAAAGG - Intronic
1048963371 8:139597863-139597885 ATTTCTCTCTTGCAGGGTTATGG - Intergenic
1049478548 8:142808098-142808120 ATGCCTTTCTTCCTGGGGCAGGG - Intergenic
1049631044 8:143657814-143657836 ATGCCTTCCCTGCAGGGTTTTGG - Intergenic
1049820821 8:144632253-144632275 ACGGCTTTCCTGGAGGGTGACGG - Intergenic
1050077081 9:1876405-1876427 ATGCCTCTCCTGCCGTGTGAGGG - Intergenic
1050905249 9:10994824-10994846 AGGCACTTCTTGCAGGATGATGG - Intergenic
1055684617 9:78757894-78757916 ATTCCTTTCTTGGTGGGTCATGG - Intergenic
1056410533 9:86321730-86321752 TTTCCTTTTTTGGAGGGTGATGG - Intronic
1056839220 9:89985120-89985142 ATGCCAATCTTGCAGGATTATGG + Intergenic
1058053472 9:100427835-100427857 ATCCCTCACTTGCAGGATGAAGG + Intronic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1060007347 9:120012322-120012344 CTGCCTTTCTTGCTGAGTGGAGG - Intergenic
1060298789 9:122361551-122361573 AATGCTCTCTTGCAGGGTGATGG + Intergenic
1061534005 9:131236366-131236388 ATACCTGTCTGGCAGGGTGGCGG + Intergenic
1062401718 9:136375728-136375750 CTGCCTCTCTTGCAGGCTGGGGG + Exonic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1189402462 X:40684193-40684215 AATCCTTTGTTGCGGGGTGAGGG + Intronic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1191822130 X:65322258-65322280 ATGCCATTCTTGAAAGGTGGGGG - Intergenic
1192934783 X:75848467-75848489 ATGCCCTTCTTACATGGTGGTGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195796322 X:108651682-108651704 ATGCCTATCTTGCATGGTAAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196561707 X:117157166-117157188 ATGTCTTTCTTGGAAGATGAAGG + Intergenic
1196708850 X:118741793-118741815 ATGTGTTTGTTGCAGGGTGGCGG + Intronic
1198438663 X:136640707-136640729 TTCCCTTTCTTCCACGGTGAAGG - Intergenic
1198735752 X:139783421-139783443 ATGCCTTTCTGACAGACTGAAGG - Intronic
1199522025 X:148746800-148746822 ATTCCTTTCTGGCAGACTGAGGG + Intronic
1199700454 X:150371654-150371676 ATGCATTACTTGTGGGGTGAGGG - Intronic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic