ID: 962851805

View in Genome Browser
Species Human (GRCh38)
Location 3:139313700-139313722
Sequence CTTTCTCCCAAGACTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4804
Summary {0: 1, 1: 1, 2: 12, 3: 217, 4: 4573}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962851805_962851809 -4 Left 962851805 3:139313700-139313722 CCTGTTTCAGTCTTGGGAGAAAG 0: 1
1: 1
2: 12
3: 217
4: 4573
Right 962851809 3:139313719-139313741 AAAGAAAGAAGAGGAAGGCAGGG 0: 1
1: 4
2: 77
3: 764
4: 4863
962851805_962851810 -3 Left 962851805 3:139313700-139313722 CCTGTTTCAGTCTTGGGAGAAAG 0: 1
1: 1
2: 12
3: 217
4: 4573
Right 962851810 3:139313720-139313742 AAGAAAGAAGAGGAAGGCAGGGG 0: 1
1: 1
2: 39
3: 388
4: 2830
962851805_962851811 3 Left 962851805 3:139313700-139313722 CCTGTTTCAGTCTTGGGAGAAAG 0: 1
1: 1
2: 12
3: 217
4: 4573
Right 962851811 3:139313726-139313748 GAAGAGGAAGGCAGGGGAAGTGG 0: 1
1: 2
2: 39
3: 402
4: 2786
962851805_962851812 7 Left 962851805 3:139313700-139313722 CCTGTTTCAGTCTTGGGAGAAAG 0: 1
1: 1
2: 12
3: 217
4: 4573
Right 962851812 3:139313730-139313752 AGGAAGGCAGGGGAAGTGGTTGG 0: 1
1: 0
2: 5
3: 126
4: 1242
962851805_962851807 -9 Left 962851805 3:139313700-139313722 CCTGTTTCAGTCTTGGGAGAAAG 0: 1
1: 1
2: 12
3: 217
4: 4573
Right 962851807 3:139313714-139313736 GGGAGAAAGAAAGAAGAGGAAGG 0: 1
1: 8
2: 88
3: 843
4: 4800
962851805_962851808 -5 Left 962851805 3:139313700-139313722 CCTGTTTCAGTCTTGGGAGAAAG 0: 1
1: 1
2: 12
3: 217
4: 4573
Right 962851808 3:139313718-139313740 GAAAGAAAGAAGAGGAAGGCAGG 0: 1
1: 7
2: 187
3: 929
4: 4564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962851805 Original CRISPR CTTTCTCCCAAGACTGAAAC AGG (reversed) Intronic
Too many off-targets to display for this crispr