ID: 962852407

View in Genome Browser
Species Human (GRCh38)
Location 3:139317970-139317992
Sequence CTGCAGGATGATACAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 4, 2: 1, 3: 18, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962852404_962852407 6 Left 962852404 3:139317941-139317963 CCTCTCTTGCACTGCATTTGCAC 0: 1
1: 0
2: 2
3: 13
4: 177
Right 962852407 3:139317970-139317992 CTGCAGGATGATACAGAGCCAGG 0: 1
1: 4
2: 1
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962852407 Original CRISPR CTGCAGGATGATACAGAGCC AGG Intronic
900144123 1:1150602-1150624 CTGCAGGGGGATGCAGAGCTGGG + Intergenic
900395575 1:2451942-2451964 CTGAAGGATGACAAAGATCCCGG - Intronic
900522232 1:3111297-3111319 GTGCAGGATCACACAGAGGCCGG - Intronic
900790389 1:4676013-4676035 CTGCACGAGGACACAGAGCTGGG - Intronic
901425660 1:9181213-9181235 CTGCAGAAGGTTCCAGAGCCTGG - Intergenic
903007543 1:20308661-20308683 CAGCAGGCAGATAAAGAGCCGGG - Intronic
903272760 1:22201895-22201917 CTGTTGGATGACACAGACCCGGG + Intergenic
904211627 1:28889687-28889709 CTGCAGGGTGAGACAGAGGCTGG + Intronic
906004054 1:42454060-42454082 CTGAAGGATGAAAGGGAGCCAGG + Intronic
908083761 1:60608656-60608678 CAGGAGGATGAGAAAGAGCCTGG - Intergenic
908640299 1:66215625-66215647 CTGCAGGAGGCTTCAGAGACAGG + Intronic
909080028 1:71098992-71099014 CTCCAGGATTATTCAGTGCCTGG - Intergenic
910682270 1:89879082-89879104 CAGCAGGGAGATACAGAGCAGGG - Intronic
910893883 1:92046879-92046901 ATGCATGATGATACAAAACCAGG - Intronic
910903614 1:92149751-92149773 CTGAAGGAGGATACAGGGCAAGG - Intergenic
914885735 1:151582890-151582912 CTGCAGGGTCATTCAGAGCCAGG - Exonic
916859083 1:168783605-168783627 CTGCTGGCTGATACACTGCCTGG - Intergenic
920210700 1:204326178-204326200 CTGCCAGCTGAAACAGAGCCCGG + Intronic
921365663 1:214371328-214371350 GTGCAACATGATACAGAGCCTGG + Intronic
921958767 1:221012273-221012295 CTGCAGGATAAAATGGAGCCTGG - Intergenic
923429450 1:233905868-233905890 CTGCCTGCTGATACAGACCCAGG + Intronic
923471426 1:234294318-234294340 CTGCTGGCCGAGACAGAGCCAGG - Intronic
1062942638 10:1435553-1435575 CTGCAGGATGGTGCAGAGGCAGG - Intronic
1064807136 10:19148031-19148053 CTGCAGGATGATGGTGACCCAGG + Intronic
1065973863 10:30825712-30825734 GTGCAGGATGAGACAGAATCTGG + Intronic
1066042215 10:31560888-31560910 CTGCTGGATCATAAAGATCCAGG - Intergenic
1066116918 10:32248765-32248787 CTTCAAAATGCTACAGAGCCAGG + Intergenic
1067926810 10:50517083-50517105 CAGGAGGATGCTACAGACCCAGG - Intronic
1071144294 10:82549676-82549698 CTGCAGAATTATGCAGGGCCCGG + Intronic
1072036496 10:91567661-91567683 CTGAAGGGTGTTACACAGCCTGG - Intergenic
1073253751 10:102137949-102137971 CTGCAGGATGAGACACTGCTGGG + Exonic
1074302095 10:112242142-112242164 CTGTAGTATAATAGAGAGCCAGG - Intergenic
1075283103 10:121158149-121158171 CTCCAGAAAGAAACAGAGCCCGG - Intergenic
1076206663 10:128609657-128609679 CTGCAGGATCCTACTGAGTCGGG + Intergenic
1078327830 11:10394944-10394966 TTGCAGGATGATGCACAGGCTGG + Intronic
1079603668 11:22341341-22341363 CTGCAGAATGTGAGAGAGCCTGG + Intronic
1079742183 11:24076694-24076716 CTGGAGGATGATACATAGAGAGG - Intergenic
1080561904 11:33471798-33471820 CTGCAGGCAGGAACAGAGCCAGG + Intergenic
1080705287 11:34686157-34686179 CTGCAGAATGATACAGACATAGG - Intergenic
1083266563 11:61549744-61549766 CTGCAGGACCACACAGAGGCAGG + Intronic
1083420466 11:62549674-62549696 CTGCAGGCTGGAACAGAGCTGGG + Intronic
1084673919 11:70623434-70623456 CTGCATGATGGGACAGAGGCAGG - Intronic
1085525659 11:77162038-77162060 CTGCAGGTGGAGGCAGAGCCAGG + Intronic
1086428087 11:86706593-86706615 CTTCAGGATGAAACAAAGCAGGG - Intergenic
1087395854 11:97597010-97597032 ATACAGGAGGATGCAGAGCCTGG + Intergenic
1087814027 11:102638733-102638755 CAGCAGGAGGGTAAAGAGCCAGG + Intergenic
1089531794 11:119134632-119134654 CTGCAGAATGATGCAAACCCAGG - Exonic
1089561626 11:119346098-119346120 GAGCAGGAGGACACAGAGCCAGG + Exonic
1091051918 11:132380012-132380034 CTTCAGGATGATAGGAAGCCTGG - Intergenic
1093297716 12:17411529-17411551 CTGAAGTATGATACACAGCTAGG + Intergenic
1096228196 12:49882568-49882590 CTGCAGGATGATCCCGACCAGGG + Intronic
1097821173 12:64130646-64130668 CTTCAGGATGATAGGGAGCATGG + Intronic
1099785649 12:87259581-87259603 CTGGATGATGATTCAGAGGCAGG - Intergenic
1101065910 12:101020508-101020530 CTGGATGATGATACAGAGATAGG + Intronic
1101364092 12:104055391-104055413 CTGCAGAATGACAGAGTGCCAGG - Intronic
1102950202 12:117026226-117026248 CTGGAGGATGAGAAAGACCCGGG - Intronic
1102950229 12:117026323-117026345 CTGGAGGATGAGAAAGACCCGGG - Intronic
1102950255 12:117026420-117026442 CTGGAGGATGAGAAAGACCCGGG - Intronic
1103937408 12:124483870-124483892 TGGCAGGATCATACAGAGCACGG - Intronic
1107061361 13:36162963-36162985 GTTTAGGATGCTACAGAGCCAGG + Intergenic
1107274404 13:38661460-38661482 TTGCAGCATGATTCAGAGCCAGG + Intergenic
1110187349 13:72690840-72690862 GTGCAGGAGGATACAGAATCAGG + Intergenic
1110594221 13:77301105-77301127 CTGAAGGATGATAGAGAGGCTGG + Intronic
1110629492 13:77691106-77691128 CAGAAGGATGATACAGACTCAGG - Intergenic
1112610603 13:100951334-100951356 CTGCAGGATGGCTCAGAGCCTGG + Intergenic
1118850358 14:69578309-69578331 CTTCAGAATCAGACAGAGCCAGG - Intergenic
1120081840 14:80226270-80226292 CTTCAGGATGATAGAGAACATGG + Intronic
1122164326 14:99810196-99810218 CAGCCAGATGCTACAGAGCCAGG + Intronic
1127798317 15:62456832-62456854 AAGCAGAATGAGACAGAGCCAGG - Intronic
1129867148 15:78917929-78917951 CCTAAGGATGCTACAGAGCCTGG - Intergenic
1131007078 15:88987147-88987169 CTCCAGGCTGATTCAGACCCTGG - Intergenic
1133439335 16:5807353-5807375 CTTCAGGATGCCACAGGGCCAGG + Intergenic
1134047693 16:11113194-11113216 CTGCATGATCAGGCAGAGCCCGG + Intronic
1137694821 16:50454539-50454561 CTGCAGGCTGACACCCAGCCAGG - Intergenic
1138521126 16:57571396-57571418 CGGCAGGCTGGTCCAGAGCCTGG + Intronic
1139281335 16:65773480-65773502 CTTCAGGGTGAGACAGAGGCAGG - Intergenic
1139569335 16:67800882-67800904 CTGCAAGAGGAGGCAGAGCCTGG - Intronic
1139653236 16:68372998-68373020 CTGCAGGATCACACCAAGCCTGG + Intronic
1142033484 16:87850044-87850066 CTGCAGGGGGATGCAGTGCCGGG - Intronic
1143375749 17:6466115-6466137 CTGGAGGCTGCTGCAGAGCCTGG - Intronic
1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG + Intronic
1146918418 17:36693024-36693046 CTGCAGGGTCATAAAGAGCTTGG + Intergenic
1147017127 17:37501138-37501160 CAGCAGAATGATACTGATCCGGG + Intronic
1147224930 17:38969078-38969100 CTGCAAAAGGATACAAAGCCAGG - Intergenic
1149413993 17:56439161-56439183 ATGCAGGATCATCCAGAGCAAGG + Intronic
1150632844 17:66892183-66892205 GTGCAGGCTGAGACAGAGCGAGG - Intergenic
1152143966 17:78556403-78556425 CAGCAGAATGAAACAGATCCAGG + Intronic
1152343751 17:79739232-79739254 CTGCAGGTTGGCACAGAGCGAGG + Intronic
1152367537 17:79865268-79865290 CTGCATAATGATACAGATCAGGG - Intergenic
1154102321 18:11487560-11487582 CCGCTGGAGGATTCAGAGCCTGG - Intergenic
1157223006 18:45840468-45840490 CTACAGGAAGAAACACAGCCTGG - Intronic
1157680812 18:49604228-49604250 CTGCAGGATGTTACAGACCTTGG + Intergenic
1157722122 18:49933151-49933173 CTGCAGGATGCTGCTGAGCCTGG - Intronic
1159866762 18:73714889-73714911 CTGGACCATGATACAGAGCTGGG - Intergenic
1163880159 19:19912843-19912865 CTAGAGTATGATACAGAGCACGG - Intronic
1164414607 19:28036120-28036142 CCGTAGTATGATACACAGCCAGG - Intergenic
1165327677 19:35123726-35123748 CTGGAGGCTGACACAGAGGCTGG + Intronic
1166269524 19:41705483-41705505 CTGATGGATGACACAGAGCAGGG + Intronic
1167418485 19:49389555-49389577 CTGCAGGGTGTTCCAGACCCTGG + Intronic
1167520549 19:49952000-49952022 CTCCAGGCTGGTCCAGAGCCTGG + Intronic
925035339 2:680566-680588 CTGCAGGATGTTGCTGAGCTTGG - Intergenic
926057093 2:9780101-9780123 GAGCAGGATGCTAGAGAGCCGGG + Intergenic
927468585 2:23355280-23355302 CTCCAGGGTGAAAAAGAGCCGGG + Intergenic
929043979 2:37773012-37773034 CTGTATGATGATACAGACTCTGG + Intergenic
929106022 2:38367045-38367067 CTGCAGGATGGAGCTGAGCCTGG - Intronic
930222559 2:48759916-48759938 CTGCAGGATGATAGGAAGCTGGG + Intronic
931246618 2:60497886-60497908 CTGCAGGATGGAAGTGAGCCAGG + Intronic
931872117 2:66472651-66472673 CTGCTGGATGAAACACAGCGTGG + Intronic
932667850 2:73711344-73711366 CCGTAGGGTGATACTGAGCCTGG - Intergenic
935318230 2:101859090-101859112 CTACAGAATGAAACAGAGGCGGG - Intronic
937601322 2:123738579-123738601 CTGCAAGGTGATACAGATGCTGG - Intergenic
938564991 2:132510506-132510528 GGGCAGGCTGAAACAGAGCCTGG + Intronic
939409045 2:141800298-141800320 CTGCAGCATGCTATACAGCCTGG - Intronic
941394295 2:164955511-164955533 CTGCAGGATGTTTCTGATCCGGG + Intronic
942611852 2:177750455-177750477 CTGCAGGACCATCCAGATCCTGG - Intronic
942947010 2:181683080-181683102 CTCCAGGATGTTTCAGAGACAGG + Intergenic
945327777 2:208502462-208502484 CTGCAGTATCATGCAGAGCATGG + Intronic
946412359 2:219521685-219521707 CTGCAGGAGGGGACAGAGGCCGG + Intronic
948182629 2:235994632-235994654 CAGCCCGATGATACAGAGACGGG + Intronic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1172563962 20:35913591-35913613 CTGCAGGATGGTACAGATGAAGG + Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1175068808 20:56314522-56314544 CTGCAGGGAGATGCAGGGCCTGG + Intergenic
1181523779 22:23466542-23466564 ATGAAGAATGATCCAGAGCCTGG + Intergenic
1182269761 22:29145942-29145964 CTGCAGGCAGATCCTGAGCCCGG - Intronic
1183361006 22:37383517-37383539 GTGCAGGATGACACAGAGCCCGG - Intronic
1183461578 22:37954064-37954086 CCACTGCATGATACAGAGCCCGG - Intronic
1203296102 22_KI270736v1_random:44407-44429 CTGTATGATGATACAGACTCTGG + Intergenic
950154451 3:10711111-10711133 CTGCAGGATGAGGAAGAGACGGG + Intergenic
954297926 3:49684488-49684510 CTGCAGGAAGATCCAGGGCTGGG + Intronic
954948585 3:54448527-54448549 CTGGAGGATGAAACAGAGGTGGG + Intronic
955034727 3:55256224-55256246 CCGAAGGATGAGAAAGAGCCAGG + Intergenic
955236027 3:57140066-57140088 CTGCATAAAGATACCGAGCCGGG + Intronic
955289488 3:57677827-57677849 ATGCAGTCTGATACAAAGCCAGG - Intronic
957156704 3:76552749-76552771 CTGAAGGATGAGACAGAGCATGG + Intronic
957558525 3:81792023-81792045 ATGCAGGCTGATTCAGATCCTGG + Intergenic
961217899 3:125175734-125175756 CTGCAGGGTGGTACATGGCCAGG + Intronic
961829399 3:129615770-129615792 CTGCAGGATGCAGCAGAGTCAGG + Intergenic
962124093 3:132596480-132596502 CTGCAGGTGGAGACTGAGCCTGG + Intronic
962852407 3:139317970-139317992 CTGCAGGATGATACAGAGCCAGG + Intronic
967870369 3:194224282-194224304 CTGGAGGAGGAAGCAGAGCCGGG - Intergenic
968084784 3:195869415-195869437 CTCCTGGAAGGTACAGAGCCTGG - Intronic
968121199 3:196127384-196127406 CTGCAGGCTGATACAGAGGACGG + Intergenic
969466534 4:7360514-7360536 GTGCAGGATGCCACAGAGCCTGG - Intronic
971197845 4:24486442-24486464 CAGGAGGAAGATACAGAGCTTGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
973554397 4:52067591-52067613 TTGGAGGATAATAAAGAGCCAGG - Intronic
973716316 4:53680741-53680763 CTCCAGGAAGAAACAGAGCAAGG - Intronic
976411017 4:84713689-84713711 TTGAAGGGTGATACAGATCCTGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977386304 4:96343979-96344001 CAGAGGGATGATACAGAGACAGG - Intergenic
978357619 4:107893592-107893614 CAGCAGGATGAGAAAGACCCAGG - Intronic
980440993 4:132844933-132844955 CTGCAGGATGGTACAGCCTCTGG - Intergenic
981004848 4:139864232-139864254 CTGCAGGAAGATACAGACTCTGG + Intronic
981145553 4:141320118-141320140 ATGAAGGATGATGCAGAGCCAGG - Intergenic
983107676 4:163709626-163709648 CTCCAAGATGATACAGGACCTGG + Intronic
985422866 4:189802005-189802027 ATGCAGGCGGATACAGAGCAAGG - Intergenic
985784910 5:1888300-1888322 CTGGAGGATGATGCAGCCCCAGG + Intergenic
987012759 5:13783829-13783851 CAGCAGCATGACACAGAGCGTGG + Intronic
987862508 5:23506317-23506339 CTGCAAGGAGATACGGAGCCTGG - Intergenic
987940433 5:24528666-24528688 ATGCATGTTGATACAGAGACAGG - Intronic
988781925 5:34530109-34530131 CTAAAGGAGGATGCAGAGCCTGG + Intergenic
990594949 5:57303301-57303323 CTGCAGGATGCTACGGTTCCTGG + Intergenic
991014823 5:61920008-61920030 CTGCTTGATGTTACAGACCCAGG + Intergenic
994043564 5:95284489-95284511 CTGCAGGTTCTTCCAGAGCCGGG + Exonic
995985584 5:118167652-118167674 CTGCAGGAAGATAAATGGCCAGG + Intergenic
998690476 5:144581917-144581939 CTGCAGGAACAAACAGATCCAGG + Intergenic
1000055549 5:157602910-157602932 CTGCAGCAAAATACAGTGCCTGG + Intergenic
1000368984 5:160517034-160517056 CTGCAGGATGACACACATGCTGG + Intergenic
1000371442 5:160540334-160540356 CTGCAGGATGTTACAGAGGAAGG + Intergenic
1001985292 5:176069383-176069405 CTGCAGGACGATTCACATCCTGG + Intronic
1002231579 5:177768747-177768769 CTGCAGGACGATTCACATCCTGG - Intronic
1002263762 5:178015001-178015023 CTGCAGGACGATTCACATCCTGG + Intronic
1002290427 5:178196681-178196703 CTGCAGGATGGTGGAGAGACAGG + Intergenic
1003739433 6:8919222-8919244 CTGAAGGATGAGAAAGAGCTAGG + Intergenic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1009610227 6:65931333-65931355 CAGCAGGATGTAACAGCGCCTGG + Intergenic
1009823849 6:68840638-68840660 CTGCAGGTTAATAGAGAACCAGG + Intronic
1012542308 6:100375464-100375486 CTGCAGCATGTGACAGAGTCTGG + Intergenic
1013197945 6:107862410-107862432 ATTAAGGATGATACAGAGCTGGG - Intergenic
1013220898 6:108076024-108076046 AAGCAGGATGACACAAAGCCCGG - Intronic
1015770254 6:136761439-136761461 CTGCAGGATGCCACGCAGCCTGG + Intronic
1017218571 6:151938876-151938898 TTGCAGGATGAAAGAGAGCTTGG + Intronic
1017684822 6:156901577-156901599 CAGGAAGATGATTCAGAGCCGGG - Intronic
1018822387 6:167383371-167383393 ATGGAGGATGGTGCAGAGCCAGG - Intronic
1018984268 6:168623941-168623963 CTGCTGGAGGTCACAGAGCCTGG + Intronic
1019060085 6:169251401-169251423 CTGCAGGAAAATAAAGAGGCAGG - Intronic
1022672718 7:32471457-32471479 CTGCAGGACGAGACTGGGCCGGG - Intergenic
1022768687 7:33445176-33445198 CTGTAGGAGGAAGCAGAGCCTGG + Intronic
1024501733 7:50117019-50117041 TTGCAGGATAATACAGATTCTGG + Intronic
1029189262 7:98760308-98760330 CTTAAGGTTGATACAGGGCCTGG + Intergenic
1031579855 7:123459519-123459541 CAGCAGGCTGCTATAGAGCCAGG - Intronic
1032865638 7:135921350-135921372 CTGCTGGATGATTCAAAGGCTGG - Intergenic
1032884108 7:136119397-136119419 GTGCAAGCTGATGCAGAGCCTGG - Intergenic
1032989556 7:137377597-137377619 CAGCAGGATGATAAAGTGCTGGG - Intergenic
1033513063 7:142079698-142079720 CTGAAGTCTAATACAGAGCCTGG + Intronic
1033541411 7:142359064-142359086 CTGCAGGAGGATGCACAGACTGG - Intergenic
1034672817 7:152870877-152870899 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1034672829 7:152870929-152870951 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1034672841 7:152870981-152871003 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1034672853 7:152871033-152871055 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1036121327 8:6020800-6020822 GTGCAGAATGAGACAGAGACAGG - Intergenic
1045224043 8:100227370-100227392 CTGCAAGATGAAGCACAGCCTGG - Intronic
1045397710 8:101777435-101777457 CTGAAGAATGATACAGTACCTGG + Intronic
1047652650 8:126940126-126940148 CTGCAGGAGGAAACAGAGCATGG - Intergenic
1048255377 8:132901406-132901428 CTGCAGGCTGGGACATAGCCTGG - Exonic
1048863444 8:138740937-138740959 CTGAAGGAAGATACTGGGCCTGG - Intronic
1056578761 9:87875032-87875054 CTTCAGGATGAGACAGGTCCTGG - Intergenic
1060630214 9:125150933-125150955 CAGCAGGATAATAAAGAGTCAGG + Intronic
1061531807 9:131219913-131219935 CTGCAGGATGATATGGGGCCTGG + Intronic
1061873499 9:133532841-133532863 CTGCAGGAGGTCACAGAGCCAGG + Intronic
1062197630 9:135282998-135283020 ATGCAGGAGGACACAGAGGCAGG + Intergenic
1062580332 9:137226616-137226638 CAGCAGGAGGATACAGCGCATGG + Intergenic
1188733321 X:33679322-33679344 CTGGGTGAGGATACAGAGCCAGG + Intergenic
1189003647 X:36972268-36972290 CTACAAGATGAGACAGAGGCTGG + Intergenic
1189045988 X:37591633-37591655 CTACAAGATGAGACAGAGGCTGG - Intronic
1190931212 X:54950898-54950920 GGCCAGGATGAGACAGAGCCAGG - Intronic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192181760 X:68920602-68920624 CTGGAGTGGGATACAGAGCCCGG - Intergenic
1196619667 X:117807453-117807475 CTGCAGGACAATACAGCACCAGG + Intergenic
1200280701 X:154774710-154774732 GGGCAGGATGTTTCAGAGCCGGG + Intronic
1200972978 Y:9176456-9176478 CTTCAGGATGATAAAAAGCATGG + Intergenic
1202138098 Y:21688053-21688075 CTTCAGGATGATAAAAAGCATGG - Intergenic