ID: 962852628

View in Genome Browser
Species Human (GRCh38)
Location 3:139319302-139319324
Sequence TTCCCAGGACAAAGCCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962852628_962852633 -2 Left 962852628 3:139319302-139319324 CCTCAATGGCTTTGTCCTGGGAA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962852633 3:139319323-139319345 AAGGTTTTGGCCAAAAAAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 304
962852628_962852632 -3 Left 962852628 3:139319302-139319324 CCTCAATGGCTTTGTCCTGGGAA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962852632 3:139319322-139319344 GAAGGTTTTGGCCAAAAAAGAGG 0: 1
1: 0
2: 1
3: 20
4: 210
962852628_962852636 24 Left 962852628 3:139319302-139319324 CCTCAATGGCTTTGTCCTGGGAA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962852636 3:139319349-139319371 TGTGTCTGAGATGAGGAGAGAGG 0: 1
1: 1
2: 4
3: 40
4: 422
962852628_962852635 17 Left 962852628 3:139319302-139319324 CCTCAATGGCTTTGTCCTGGGAA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962852635 3:139319342-139319364 AGGGTGCTGTGTCTGAGATGAGG 0: 1
1: 0
2: 6
3: 25
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962852628 Original CRISPR TTCCCAGGACAAAGCCATTG AGG (reversed) Intronic
901099401 1:6707835-6707857 TCTCCAGGGCAAAGCCTTTGAGG + Intergenic
902537184 1:17126278-17126300 CTCACAGGACAAAGGCACTGAGG - Intergenic
904516438 1:31059323-31059345 TTCCCAGGACGACGCTATGGTGG - Exonic
906781099 1:48573553-48573575 TTACCAGGACAAATTCATTTAGG - Intronic
907022967 1:51086801-51086823 TTCCCAGGGCTGAGCCAATGTGG - Intergenic
908668883 1:66523536-66523558 TTCCCAGCACACAGTTATTGTGG - Intergenic
914727268 1:150338309-150338331 CTCACAGATCAAAGCCATTGGGG - Exonic
915357733 1:155266031-155266053 TACCTAGGGCAAAGCCAGTGAGG + Intronic
917407358 1:174721720-174721742 TTCCCAGTACAAAGTATTTGGGG + Intronic
919260340 1:195184889-195184911 TTCTTAGAACAAAGCCTTTGGGG - Intergenic
919775712 1:201192776-201192798 TTCCCATTCCAAAGCCAATGGGG + Intronic
920382368 1:205542741-205542763 TTCCTCTGACAAAGCCACTGGGG - Intergenic
921969189 1:221126948-221126970 ATCCCAGGAAAAAGCCTATGTGG - Intergenic
922099402 1:222469310-222469332 TTCCCAGCACATGGCCAGTGAGG + Intergenic
922261438 1:223948805-223948827 TTCCCAGCACATGGCCAGTGAGG + Intergenic
922735636 1:227976938-227976960 TTCCCAGCACATGGCCAGTGAGG - Intergenic
923520532 1:234732050-234732072 TTCCCAGGACCTGGCCAATGTGG + Intergenic
924408426 1:243777034-243777056 TTTCCAGGAGGAAGCAATTGTGG + Intronic
1063560286 10:7119810-7119832 TTCCCATGACAATGCTATAGGGG - Intergenic
1065008290 10:21399743-21399765 TTCTCAGCACACAGCTATTGTGG + Intergenic
1066733873 10:38454570-38454592 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1067221946 10:44350583-44350605 TTCCCATGACAATGACATTGAGG + Intergenic
1067563909 10:47322896-47322918 TTCGCAGGACAAAACCAGGGTGG + Exonic
1070175456 10:73965837-73965859 GTCCCAGAACACAGCGATTGGGG - Intergenic
1070475655 10:76826653-76826675 TTTCCAGGAAACAGCCATTGTGG - Intergenic
1074822531 10:117191566-117191588 TTGCCAGAGCAAAGCCAATGGGG + Intergenic
1076541126 10:131215580-131215602 TTCCCGGGACAAAGGGATTTCGG + Intronic
1076739523 10:132476458-132476480 TTCCCAGGACACAGCCCAGGTGG - Intergenic
1076783771 10:132739007-132739029 TTCCCAAGAGAAAGCCCTTCTGG - Intronic
1077238088 11:1492896-1492918 TCCCCATGGCACAGCCATTGTGG - Intronic
1082095903 11:48129150-48129172 TTCCCAGGATAAATCCCTTTTGG - Intronic
1084740245 11:71134779-71134801 TCCCTATGACAAAGCCAGTGGGG - Intronic
1086589360 11:88493974-88493996 TTCTCATGCAAAAGCCATTGTGG - Intergenic
1087571624 11:99934635-99934657 ATCCCAGCACAAGGCCATGGTGG + Intronic
1089375707 11:117993275-117993297 TCCCGAGGATGAAGCCATTGTGG - Exonic
1095804268 12:46301214-46301236 GTCCCAGAAAAAAGCCACTGGGG - Intergenic
1096588895 12:52644236-52644258 ATCCCGGGCCAAAGCCTTTGTGG + Intergenic
1098080531 12:66780362-66780384 TACCCAAGTCAAAGCCAGTGAGG + Intronic
1099591836 12:84602223-84602245 TACCCAGGACAAAGGGATTTCGG - Intergenic
1101538729 12:105644836-105644858 TTGGCAGGGCAAAGCCATTCGGG - Intergenic
1102072963 12:110036867-110036889 TTCACAGGTCAGTGCCATTGGGG + Intronic
1103469143 12:121165974-121165996 TTCCCAGGAGTGAGCCAGTGTGG - Intronic
1103902044 12:124308452-124308474 TTCCAAGGACAAGGGCAGTGTGG - Intronic
1104135994 12:125939520-125939542 TTGCCTGGACAAAGTCTTTGGGG + Intergenic
1106170455 13:27283992-27284014 GACACAGGACAATGCCATTGGGG - Intergenic
1111319126 13:86602071-86602093 TTCCAAGTACAAATACATTGGGG + Intergenic
1112203075 13:97297130-97297152 TTAACAGAACAAAGGCATTGAGG - Intronic
1118695834 14:68384365-68384387 CAGCCAGGACATAGCCATTGTGG - Intronic
1119552206 14:75523157-75523179 TTCCCAGGAGACAGCCAATAGGG + Intronic
1125212463 15:37233231-37233253 ATCCCAGGTCAAAGACAGTGAGG + Intergenic
1125392846 15:39213626-39213648 TGCCCAGAACAAAACCATTCCGG - Intergenic
1126360596 15:47841873-47841895 TTCCCAGGAATATGCCATTTAGG - Intergenic
1127655197 15:61048942-61048964 TCCCCAGTACAAAGGCATAGCGG - Intronic
1128708529 15:69855087-69855109 TGCCCAGGGCAGAGCCAGTGGGG - Intergenic
1129877670 15:78987140-78987162 TTCCAGGGACAAACCCAATGTGG - Intronic
1132070620 15:98773858-98773880 GCCTAAGGACAAAGCCATTGTGG + Intronic
1133011627 16:2915704-2915726 TTCCCAGGCTCAAGCCATTCTGG - Intronic
1135415332 16:22264516-22264538 ATCCCAACACAAAGCCACTGGGG - Intronic
1138046865 16:53734109-53734131 TACCCAGGTCAAATCCATTAAGG + Intronic
1138754145 16:59461386-59461408 TTTCTAGGACAAATCCAGTGTGG + Intergenic
1139073132 16:63408450-63408472 TTCCAAGCAAAAAGTCATTGTGG - Intergenic
1141087247 16:81105021-81105043 TTTGCAGGACAAAGGCATTGTGG + Intergenic
1141188522 16:81806816-81806838 TGGCCAGGACAAAGCCTTCGAGG + Intronic
1141664452 16:85458644-85458666 TTCCCAGGACAACCCCACTTTGG - Intergenic
1142702822 17:1674500-1674522 TTTCCAGGACATAGCCACTGAGG - Exonic
1143981171 17:10871351-10871373 TTCCCATCACAAAGCATTTGGGG - Intergenic
1144181982 17:12760896-12760918 CTCCTAGGACAAAGGCAGTGAGG - Intronic
1144667098 17:17109390-17109412 ATCCCAGTACACAGGCATTGTGG - Intronic
1147358208 17:39913885-39913907 TTCCAAAGACAAATCCATTTTGG + Intronic
1147367731 17:39970382-39970404 TTCCCAGGAACTAGACATTGTGG - Intronic
1148216702 17:45837349-45837371 TTCCCGAGACAATGCCAGTGGGG + Intergenic
1150492439 17:65583842-65583864 TTCCCAGGAGGAAGCCAGAGGGG - Intronic
1151323490 17:73365328-73365350 TTCCCAGGACACATTCACTGAGG + Exonic
1151898103 17:76993973-76993995 TTCCCAGGGCAAGGCCCTGGGGG - Intergenic
1151955857 17:77379860-77379882 CTCCCTTGACAAAGCCACTGAGG + Intronic
1152615186 17:81334590-81334612 TTCCCAGGCCACAGCCCTGGGGG - Intergenic
1154463868 18:14623494-14623516 TTCCCAGCACAGTGCCTTTGTGG - Intergenic
1158907335 18:62026736-62026758 TTCCCAAGACAAATTCATTCTGG - Intergenic
1159005108 18:63004323-63004345 TTCCCTGGAGAAGGCCAGTGTGG + Intergenic
1160988676 19:1851842-1851864 TCCCCAGGAAAAAACCACTGTGG - Intergenic
1162844695 19:13383178-13383200 TACCAAGGACAAAGCAATAGTGG + Intronic
1163850027 19:19657434-19657456 TTCCCAGGGCAAGGCCTCTGGGG + Intronic
1165053008 19:33155031-33155053 ATCACAGGAGAAAGACATTGAGG + Intronic
1165721965 19:38085518-38085540 TTACAAGGAAAAAGCCAATGAGG + Intronic
1167173754 19:47851230-47851252 TTCCCAAGACAAAGGGAATGTGG + Intergenic
1168681134 19:58316591-58316613 TTCCCAGGACATAGAGATTGTGG + Intergenic
925718471 2:6806631-6806653 CTCACTGGACAAAGCCAGTGAGG + Intergenic
925998570 2:9311833-9311855 TTCCCAGGACATGGCCACTCTGG - Intronic
926333610 2:11846844-11846866 TTCCAAAGACAAAGAAATTGAGG - Intergenic
928087176 2:28353077-28353099 TTCCCAGGAGAAACTCAATGGGG - Intergenic
928726122 2:34175678-34175700 CTCCCAGGTCTAAGACATTGTGG + Intergenic
929769472 2:44879712-44879734 TCCCCAGGCCAGAGCCCTTGGGG + Intergenic
930978894 2:57497766-57497788 TCCACAGCACAAAGCCAGTGTGG + Intergenic
932280916 2:70491274-70491296 CTCCCAGGACAAACCCATGTTGG + Intronic
933145057 2:78841920-78841942 TTCCCAGGAAAATGCCATCCAGG + Intergenic
933583080 2:84149418-84149440 TTGCCATGAAAAAGGCATTGAGG - Intergenic
938742006 2:134241281-134241303 TTCCCAGGAAGAAACCATAGTGG - Intronic
939558037 2:143700783-143700805 TGCCCAGGTCAGAGCTATTGGGG - Intronic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
944400010 2:199315018-199315040 TTACCAGTACCAGGCCATTGTGG - Intronic
946115145 2:217455012-217455034 TCCCCATGAGAAAGCCCTTGTGG + Intronic
1169192785 20:3668631-3668653 CTCCCAGGACAGAGCCCTTTTGG + Exonic
1169960546 20:11154650-11154672 ACCCCAGGGCAGAGCCATTGTGG + Intergenic
1170048792 20:12116503-12116525 TTTCCAGGATAAAGCCAGAGTGG + Intergenic
1170968346 20:21096293-21096315 ATCTCAGGACCCAGCCATTGGGG + Intergenic
1172954248 20:38744360-38744382 GTCCCAGTCCAAAGCCATTCAGG + Intergenic
1173440884 20:43075011-43075033 TTCCCCGGACAGAGCCTCTGGGG + Intronic
1174483105 20:50844927-50844949 TCCCCCAGACAAAGCCCTTGTGG - Intronic
1176279362 20:64291774-64291796 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1176810663 21:13534879-13534901 TTCCCAGCACAGTGCCTTTGTGG + Intergenic
1178138198 21:29652099-29652121 TTCCCAGTTCATAGCCTTTGGGG + Intronic
1179333456 21:40427684-40427706 TTCCAATGACAAAGCCAATGGGG - Intronic
1179484289 21:41699791-41699813 CTCCCAGCACAAAGCCATGTTGG - Intergenic
1180180911 21:46118302-46118324 CTCCCAGAAAAAAGCCCTTGGGG - Intronic
1182112299 22:27732435-27732457 TTCCTGGGACAAAGCCATAAGGG + Intergenic
1184778211 22:46633721-46633743 ATCCCAGGAAGAATCCATTGTGG + Intronic
1184810093 22:46825356-46825378 TTCCAAAGGCAGAGCCATTGCGG - Intronic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
950907282 3:16550906-16550928 TTTCCAGGACAATGCCTTTGCGG - Intergenic
951040877 3:17987831-17987853 TTCCCAGGTCAAAGACAATATGG - Intronic
951768597 3:26229020-26229042 TTGTGAGGACAAAGCCATGGTGG - Intergenic
954297282 3:49681279-49681301 TCCCCAGCACAAAGCCTCTGCGG + Intronic
954648935 3:52148322-52148344 CTCCCAGGACAAAGGAATGGGGG + Intronic
954851626 3:53605873-53605895 GTCCCAGGACCAAGCCCTTGGGG + Intronic
954881947 3:53842607-53842629 TTCCTAGGAGAAACCCCTTGAGG - Intronic
958452764 3:94294390-94294412 TTACCAGGAAATAGCCCTTGTGG - Intergenic
959217390 3:103469161-103469183 TTCCTAGGAAATAGCCTTTGAGG - Intergenic
962481531 3:135802368-135802390 TTCCAAGGAAAAATCCACTGCGG - Intergenic
962852628 3:139319302-139319324 TTCCCAGGACAAAGCCATTGAGG - Intronic
963860119 3:150300787-150300809 TTCGGGGGAAAAAGCCATTGAGG + Intergenic
969080466 4:4613937-4613959 TTCCCAGGGCCAGGCCATGGTGG - Intergenic
969595056 4:8144036-8144058 TTCCCAGGTCAATGCCAAGGAGG + Intronic
969883741 4:10196961-10196983 TTCCCAGGAAAAAGTTTTTGTGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
974779696 4:66537989-66538011 TTCTCAGGACTAGGCCACTGTGG - Intergenic
976425463 4:84897789-84897811 ATCCCAGGACAAACCTATTCTGG + Intronic
978054751 4:104249491-104249513 TTCCCAGGCCAAACCCTCTGGGG + Intergenic
978466013 4:109010201-109010223 TTCCCAGGAGTAAACCCTTGGGG - Intronic
978622311 4:110645006-110645028 TTCCAAGGACATAGCCTGTGGGG + Intergenic
978880875 4:113701176-113701198 TCCCCAGGATAAAGCCTTTTGGG + Intronic
979260221 4:118637559-118637581 TTCCCAGCACATGGCCAGTGTGG - Intergenic
979699453 4:123651499-123651521 TCCCCAGGAAGAAACCATTGAGG + Intergenic
985696840 5:1345505-1345527 TCCCCAGTACAAACCCATTGTGG + Intergenic
986155233 5:5167749-5167771 ATCCCAGGGCAAAGCACTTGTGG - Intronic
990158331 5:52905557-52905579 TTCTCAGGAGAAAGCAGTTGTGG + Intronic
991192050 5:63885913-63885935 TCCACAGGACAAAGCTCTTGTGG - Intergenic
991977884 5:72200439-72200461 TTCCCAGTACAAAGCCAAACAGG - Intronic
993555919 5:89338189-89338211 TTGCCAGAAAAAAGCAATTGGGG - Intergenic
994011555 5:94909577-94909599 TTTTCAGGACACATCCATTGAGG - Intronic
994484208 5:100374685-100374707 TTCCCAGGTTCAAGCAATTGGGG - Intergenic
995566601 5:113437436-113437458 TTCCAAGGATAAAGACAATGAGG + Intronic
996477670 5:123939305-123939327 TTCCCAGGAAAATTCCAGTGGGG - Intergenic
996510773 5:124313620-124313642 CTCTCAGAACAAGGCCATTGGGG - Intergenic
998125052 5:139613002-139613024 AGCCAAGGACAAAGCCATTCTGG - Intronic
999380401 5:151117489-151117511 CTCACAGGACAAAGCCATATGGG - Intronic
1000266873 5:159646596-159646618 TTCCCTGAACACAGTCATTGTGG + Intergenic
1002168958 5:177364633-177364655 TGCCCAGGACAGAGCCAGAGAGG + Intronic
1002753757 6:143474-143496 TTCCCAGCACATGGCCAGTGAGG + Intergenic
1002878394 6:1231229-1231251 TTCCCTGGACGTAGCCAATGTGG - Intergenic
1004827565 6:19439938-19439960 TTCTACAGACAAAGCCATTGAGG + Intergenic
1006231340 6:32589650-32589672 GTCCCCAGACAAAGCCAGTGGGG + Exonic
1008632982 6:53381707-53381729 TTCCCAGGAGAAAGACCTGGAGG - Intergenic
1018284852 6:162226383-162226405 TTCCCATTACAGTGCCATTGTGG - Intronic
1019829419 7:3311900-3311922 CCCTCAGGACTAAGCCATTGGGG - Intronic
1019883727 7:3885502-3885524 TTGATAGGACAAAGCCATGGTGG - Intronic
1022095912 7:27141611-27141633 TTTTCAAGACAAAGCCATTCAGG + Exonic
1022468985 7:30670420-30670442 CCCTCAGGACAGAGCCATTGAGG + Intronic
1025051516 7:55737994-55738016 TTCCCAGCACATGGCCAGTGAGG + Intergenic
1025128479 7:56363661-56363683 TTCCCAGCACATGGCCAGTGAGG + Intergenic
1027997014 7:85436970-85436992 TCACCAGGACAAAGCAATTCAGG + Intergenic
1028303812 7:89235828-89235850 TTCTGAGTACAAAGACATTGTGG - Intronic
1029169394 7:98620038-98620060 TTCCCTGGATAATGCCAGTGGGG - Intronic
1029531267 7:101126856-101126878 TTCTCAGGCCAAGGCTATTGGGG + Intergenic
1031263165 7:119548813-119548835 TGCCCAGGAGAAAGTCAATGTGG + Intergenic
1032052451 7:128657552-128657574 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1032328121 7:130951212-130951234 CTCGCAGGACAAAGTCAGTGGGG + Intergenic
1032715554 7:134506162-134506184 TTTCCTGGACAAAGCCATGATGG - Intergenic
1033618779 7:143042899-143042921 TTCACAGGAGAGAGCCAGTGTGG - Intergenic
1034479879 7:151311416-151311438 TTCCCAGGACAGTGCCCTAGTGG + Intergenic
1039460702 8:37741683-37741705 ATTCCAGGACAAAGGCATTTAGG + Intronic
1039471233 8:37814926-37814948 GTCCCAGGAAGGAGCCATTGCGG - Exonic
1041111487 8:54487102-54487124 TTCCCAGGTCAAAGTCACAGAGG - Intergenic
1042642878 8:70955040-70955062 CTCCCAGGACAAAGCTCTCGTGG - Intergenic
1046512587 8:115218056-115218078 TTCCCTGGAAAAATCAATTGTGG + Intergenic
1049956342 9:696435-696457 TTCCCAGGACAGAGCAGTTGAGG + Intronic
1051330798 9:16023065-16023087 TTCTCAGGTCAAAGCATTTGGGG + Intronic
1052866433 9:33467193-33467215 TTTCCAGGACGGAGCCATTCGGG - Exonic
1055842509 9:80522210-80522232 TTCCCAGGACAAACCCTATGTGG + Intergenic
1056170350 9:83979738-83979760 TGCCCGAGACAAAGCCATCGAGG + Intronic
1056319753 9:85425087-85425109 TTCCCCAGAAAAAGCCATGGAGG + Intergenic
1059299212 9:113298920-113298942 TTCCCAGGACAAAGGGAGGGAGG - Exonic
1059740209 9:117142789-117142811 TTCTCAGAACAAAGGCACTGAGG - Intronic
1059774933 9:117465208-117465230 GTCCCAGGACATAGACAATGGGG + Intergenic
1060506212 9:124200151-124200173 TTCCCAGAATAAATACATTGGGG + Intergenic
1062083891 9:134638657-134638679 TTCCCAAGACAAAGGCCTTGAGG - Intergenic
1187469370 X:19554999-19555021 TTTCCATGACTAACCCATTGTGG + Intronic
1187830325 X:23374515-23374537 ATCCTGGGACAAAGCCAGTGTGG - Intronic
1189380355 X:40498455-40498477 TTCCGAAGACAAAGCCCATGAGG - Intergenic
1190014888 X:46818400-46818422 CTCCCAAGACAAAGCCATCCTGG + Intergenic
1190113361 X:47609551-47609573 TTCCCTGGAAAAAGACTTTGAGG - Intronic
1193060112 X:77197068-77197090 TTCCTAGGACAAAGCACCTGGGG - Intergenic
1194189013 X:90811412-90811434 TTCCCAGGCCAAAAACGTTGGGG - Intergenic
1195328542 X:103777531-103777553 TTCCCATGGTCAAGCCATTGAGG - Intronic
1195363267 X:104105155-104105177 TTCCCAGGCCTATGCCCTTGGGG - Exonic
1195369475 X:104158734-104158756 TTCCCCTGAAAAAACCATTGTGG - Intergenic
1196035686 X:111141181-111141203 TTCCCAGGAGGAAGTCACTGTGG - Intronic
1196899764 X:120371191-120371213 TACCCTGGAGAAAGCCATTTAGG - Exonic
1198242237 X:134797321-134797343 TCCCCAGGCCAATGCCATCGAGG - Intronic
1198670867 X:139079442-139079464 TTCTGAAGACAAAGCCTTTGGGG - Intronic
1199999951 X:153055301-153055323 TGACCAGGAAAAAGCCCTTGGGG + Intergenic
1200535594 Y:4393314-4393336 TTCCCAGGCCAAAAACGTTGGGG - Intergenic
1201509439 Y:14742308-14742330 TACCTACGACAAAACCATTGTGG + Intronic
1202047698 Y:20751061-20751083 TTCCCAGCACCAATCCATGGGGG + Intergenic
1202273599 Y:23094181-23094203 TTTCCAGGACAATGCCTTTGTGG - Intergenic
1202292427 Y:23326500-23326522 TTTCCAGGACAATGCCTTTGTGG + Intergenic
1202381706 Y:24279929-24279951 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1202426596 Y:24727926-24727948 TTTCCAGGACAATGCCTTTGTGG - Intergenic
1202444193 Y:24942160-24942182 TTTCCAGGACAATGCCTTTGTGG + Intergenic
1202489079 Y:25390197-25390219 TTCCCAGCACATGGCCAGTGAGG + Intergenic