ID: 962855873

View in Genome Browser
Species Human (GRCh38)
Location 3:139344176-139344198
Sequence CGGCCTCGGAGCTGAACCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962855873_962855881 6 Left 962855873 3:139344176-139344198 CCGCCGGTTCAGCTCCGAGGCCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 962855881 3:139344205-139344227 GACCTTCCGGACTTTCGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 32
962855873_962855880 5 Left 962855873 3:139344176-139344198 CCGCCGGTTCAGCTCCGAGGCCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 962855880 3:139344204-139344226 TGACCTTCCGGACTTTCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
962855873_962855877 -7 Left 962855873 3:139344176-139344198 CCGCCGGTTCAGCTCCGAGGCCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 962855877 3:139344192-139344214 GAGGCCGGTAAGTGACCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 62
962855873_962855884 17 Left 962855873 3:139344176-139344198 CCGCCGGTTCAGCTCCGAGGCCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 962855884 3:139344216-139344238 CTTTCGCTGGGGCGTTCTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
962855873_962855879 4 Left 962855873 3:139344176-139344198 CCGCCGGTTCAGCTCCGAGGCCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 962855879 3:139344203-139344225 GTGACCTTCCGGACTTTCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 29
962855873_962855885 18 Left 962855873 3:139344176-139344198 CCGCCGGTTCAGCTCCGAGGCCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 962855885 3:139344217-139344239 TTTCGCTGGGGCGTTCTTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962855873 Original CRISPR CGGCCTCGGAGCTGAACCGG CGG (reversed) Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
924797233 1:247301097-247301119 CGGCCTCGGTGCTGCTCCGGTGG + Exonic
1071942460 10:90605249-90605271 AGGCCTGGGAGCTGATCAGGTGG + Intergenic
1076487451 10:130833816-130833838 CGACTTCGGCGCTGAACAGGCGG + Intergenic
1076747710 10:132522739-132522761 CTGCCTCGGAGCTGGCCCAGGGG - Intergenic
1096148767 12:49295995-49296017 CGGACTGGGAGCTGAAAAGGGGG - Intronic
1101553376 12:105784442-105784464 CAGCCTGGGAGTTGTACCGGGGG - Intergenic
1103167026 12:118778946-118778968 CGGCCTTGGAGGTGACCCAGAGG - Intergenic
1129602623 15:77009203-77009225 GGGCCTCGGAGCTGAGCCTGAGG - Intronic
1132111465 15:99105090-99105112 CGGCCTCGCCGCTGCCCCGGAGG - Exonic
1134024695 16:10944821-10944843 AGGCCTCGGGGCTGGACAGGGGG + Intronic
1136057090 16:27698509-27698531 CGGGCTGGGAGAGGAACCGGGGG + Intronic
1136129649 16:28211747-28211769 CGGCCCCGAGGCTGAACGGGCGG + Exonic
1142619150 17:1154095-1154117 AGTCCTCGGAGCAGAACTGGGGG - Intronic
1143405493 17:6674804-6674826 GGGCCTCGGGGCTGAGCCAGGGG + Intergenic
1145260648 17:21352539-21352561 CGGCCTAGGGGCTGCACTGGGGG - Intergenic
1146299599 17:31677863-31677885 CAGGCTCTGAGCTGAAGCGGTGG + Intergenic
1148693453 17:49545799-49545821 GGGCCTAGGAGCAGAACCGGGGG + Intergenic
1150228515 17:63537216-63537238 CAGCCTTGGAGCTGAACCCCTGG - Intronic
1152383201 17:79952796-79952818 CGGCGTCGGAGCTGGACGGGGGG + Exonic
1152805027 17:82351659-82351681 CGGCCGTGGAGCTGGACCGAGGG + Intergenic
1153618790 18:6957023-6957045 TGGCATCGGAGCTGACCTGGGGG - Intronic
1157568969 18:48699512-48699534 CGGCCTGGGAGCTTAGCAGGTGG + Intronic
1161241149 19:3224672-3224694 CGGACTCGCAGCTGGAGCGGCGG - Intergenic
1163304830 19:16471627-16471649 CGGCCTGGGAGCTTCAGCGGCGG + Intronic
1164958271 19:32405526-32405548 CGGCCGCGGAGCTGCAGTGGCGG - Intronic
1165853993 19:38869312-38869334 GGGCCTCGGAGCTGAGCCCCCGG + Exonic
937991410 2:127664341-127664363 CCGCGTCGGGGCTGTACCGGCGG - Exonic
948642647 2:239385363-239385385 AGTCCTCGGAGGTGACCCGGAGG - Intronic
1172759945 20:37314806-37314828 CTGCCTCGGATCTGATCCAGAGG - Intronic
1178373970 21:32051068-32051090 TGGCATCGGAACTGAACTGGAGG + Intergenic
1179729152 21:43357918-43357940 CGGCCTGGGAGCTGCCCCGAGGG - Intergenic
1180183171 21:46126986-46127008 CTGCCTCGGAGCTGCAGCTGCGG + Intronic
952942223 3:38453885-38453907 CGGCCACGGAGCCGAGCCAGCGG - Exonic
962588135 3:136862482-136862504 CAGGCTCGGAGCCGAGCCGGAGG + Intronic
962855873 3:139344176-139344198 CGGCCTCGGAGCTGAACCGGCGG - Exonic
984771962 4:183444317-183444339 CGGCGCCGCAGCTGACCCGGCGG + Intergenic
987141454 5:14951138-14951160 AGGCCTCGGACCAGTACCGGTGG - Intergenic
997013325 5:129904367-129904389 CGGGCTCCGAGCTGGCCCGGAGG - Intergenic
1010066283 6:71686245-71686267 CCCACTCGGAGCTGAACTGGCGG + Intergenic
1020100947 7:5394174-5394196 GGGTCTCTGAGCTGAGCCGGAGG + Intronic
1020204541 7:6104894-6104916 CGGGCGCGGCGCTGACCCGGAGG + Exonic
1023135665 7:37049292-37049314 CGGCCCAAGAGCTGAACCAGGGG - Intronic
1023585685 7:41727254-41727276 GGGTCCCGGAGCTGAATCGGGGG - Intergenic
1030884615 7:114922463-114922485 CGGCGTCTGGGCTGAGCCGGAGG + Exonic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033477123 7:141702007-141702029 CGGCCGCGGAGCCGCCCCGGAGG - Exonic
1038499458 8:28031348-28031370 AGGCATCAGAGCTGAACCAGTGG + Exonic
1056170360 9:83979781-83979803 CGGGGTCGGAGCTGGAGCGGCGG - Intronic
1057899907 9:98940498-98940520 AGGCCTGGGAGCTGAAGTGGGGG - Intergenic