ID: 962856110

View in Genome Browser
Species Human (GRCh38)
Location 3:139346319-139346341
Sequence TATGGTATACAGGAGAGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962856110_962856118 20 Left 962856110 3:139346319-139346341 CCGTACCTCTCCTGTATACCATA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 962856118 3:139346362-139346384 CACACCTCCCACTTATACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962856110 Original CRISPR TATGGTATACAGGAGAGGTA CGG (reversed) Intronic
902524623 1:17048138-17048160 TACGGAGTACAGGGGAGGTAGGG - Intronic
907664081 1:56418726-56418748 GATGGTATACAGAAGAGAGATGG - Intergenic
909780106 1:79534135-79534157 TGTGGCATAGAGGAGAGTTAAGG + Intergenic
911505205 1:98740298-98740320 TCTACTATAAAGGAGAGGTAAGG - Intronic
911790030 1:102003103-102003125 TAGGGTATTTAGGAGAGGTAGGG - Intergenic
914441670 1:147713008-147713030 TATGGAACAAAGGGGAGGTAGGG + Intergenic
916618307 1:166468015-166468037 TCTGGAACACAGGAGAGGTAAGG + Intergenic
917829469 1:178864635-178864657 TATGGTGCACAGGAGTGGTTCGG + Intronic
920976484 1:210790727-210790749 TATGGCTTACAGTAGAAGTAAGG - Intronic
921137410 1:212273906-212273928 TATGGGACACAGAAGAGGAAAGG - Intergenic
922329962 1:224565749-224565771 TGTGGTGTACAGGAGAAGCAGGG - Intronic
923849189 1:237774683-237774705 AATGGAAGCCAGGAGAGGTAAGG - Intronic
1062821949 10:541478-541500 TGTGGGATCCAGGAGAGATATGG - Intronic
1064127526 10:12676336-12676358 TATTTTATACAGGAGAGCTTGGG - Intronic
1069332010 10:67303876-67303898 TATGGCATTCAGAAGAGGGAAGG - Intronic
1069971434 10:72173538-72173560 TATAGTCTACAGTAGAGTTAAGG - Intronic
1071088550 10:81892678-81892700 GAGGGGTTACAGGAGAGGTAGGG + Intronic
1071365002 10:84890577-84890599 TCTGCTATAGAGGAGAGGTGTGG - Intergenic
1074193981 10:111163607-111163629 TATGGTATGTAGTAGAGGTCAGG + Intergenic
1074350734 10:112734255-112734277 CATGGTATACAGGTGAGGGATGG - Intronic
1078259540 11:9691967-9691989 TATGGCTTACAGGATAGGTAAGG - Intronic
1079053980 11:17189322-17189344 TCTGGTATACATGCCAGGTACGG + Intronic
1080531000 11:33176398-33176420 TATGTTTTACAGGTGAGGCATGG - Intergenic
1080840153 11:35976465-35976487 GATCGTGTACAGGAGAGGTATGG + Intronic
1081119116 11:39242694-39242716 TATGGTAGACAGGAAAGGCCTGG + Intergenic
1082025894 11:47571839-47571861 CATGGGATACAGGACAGGGATGG + Intronic
1082765997 11:57168400-57168422 GGAGGTATGCAGGAGAGGTATGG - Intergenic
1085936721 11:81154677-81154699 TATGGTATCCAGGTTATGTATGG - Intergenic
1087566620 11:99867887-99867909 TATGGTATACAAGAGACAAAAGG + Intronic
1087738330 11:101859452-101859474 TGTGGTAGACAGTAGAGGGAGGG - Intronic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1089518484 11:119048565-119048587 TATGGGACAAAGGAGGGGTAGGG + Intronic
1097689420 12:62720594-62720616 AATGGTATACTGGTGAGATACGG + Intronic
1098110579 12:67117755-67117777 TATAGGAAACAGGAGAGGGAGGG - Intergenic
1099982901 12:89627609-89627631 TATGGTATACAGTAGATTTTTGG + Intronic
1101484564 12:105140305-105140327 TATGTTCTACAGGAGAAGCATGG + Exonic
1101488643 12:105191905-105191927 TATGGGAGAAAGGAGAGGGAGGG - Intronic
1102723630 12:115039159-115039181 CATGGGAAAGAGGAGAGGTAGGG + Intergenic
1105910695 13:24863431-24863453 AATAGCATTCAGGAGAGGTAGGG + Intronic
1106286207 13:28320158-28320180 TATGGGATAAAGGAGAGACAAGG + Intronic
1108786414 13:53908040-53908062 TATGCAATAAAGGAGAGATAGGG - Intergenic
1110338566 13:74362410-74362432 TAGGTTATAAAGGAGAGGAATGG + Intergenic
1111290380 13:86160361-86160383 TATAGGAGACAGGAGAGATATGG + Intergenic
1111714350 13:91860790-91860812 TATGGTATACAGGCCGGGCACGG - Intronic
1113249283 13:108433829-108433851 TATGGGGTGGAGGAGAGGTATGG - Intergenic
1113860109 13:113476826-113476848 TATGGTATGCGGTAGAGGTCAGG + Intronic
1120763823 14:88310145-88310167 TATGGTATATGAGAGAGATATGG - Intronic
1120768135 14:88350441-88350463 TATTGTATACAGGAAAAATATGG + Intergenic
1129149820 15:73681590-73681612 TAGGGTATTCAGGAAAGGGAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132109116 15:99089284-99089306 TGTGGAATAAAGGAGAAGTATGG - Intergenic
1136315383 16:29451883-29451905 TATGGCATACTGAAGAGGTGGGG - Intronic
1136429960 16:30191225-30191247 TATGGCATACTGAAGAGGTGGGG - Intergenic
1137417901 16:48301873-48301895 AATGGTACAGAGGAGAGGAATGG - Intronic
1143843673 17:9755627-9755649 CATTATAAACAGGAGAGGTATGG - Intergenic
1150689409 17:67351637-67351659 TATTGTATAGTGGTGAGGTATGG + Intronic
1154084427 18:11289407-11289429 TATATTATTCAGGAGAGGTTAGG - Intergenic
1155022433 18:21908893-21908915 TAAGGAATACAGCAGAGGTCAGG + Intergenic
1156234233 18:35185501-35185523 TATGGTATAATGGGGAGGTGTGG - Intergenic
1157391348 18:47306205-47306227 TGTGATATACAGGGGAAGTATGG + Intergenic
1157628997 18:49078459-49078481 TATAGTATATAGGAGAGGAGAGG - Intronic
1159933451 18:74338519-74338541 TATTGTATAAAGGAGAAGCAGGG + Intronic
1164068821 19:21747002-21747024 TCTGTTATAAGGGAGAGGTATGG - Intronic
928151468 2:28833681-28833703 TATGGTATAAACCAGAGGTTCGG - Intronic
933708013 2:85305784-85305806 TATGGTACACGGGCAAGGTAAGG - Intronic
937174657 2:119917441-119917463 GATGGTATACAGGCCAGGTGCGG + Intronic
939699529 2:145372892-145372914 CATGCCATACAGGAGAGGTAGGG + Intergenic
940074595 2:149727132-149727154 AATGGTATAATTGAGAGGTAGGG - Intergenic
944141839 2:196465082-196465104 TATGCTCTCCTGGAGAGGTAGGG + Intronic
944342646 2:198621356-198621378 TATGGGAGACAGGAAATGTAAGG - Intergenic
944454530 2:199879356-199879378 TTTGGAATGCAGGAGAGGCAAGG + Intergenic
945542929 2:211111072-211111094 AATGGTAAACAGGAAAGATAAGG - Intergenic
945842489 2:214904791-214904813 TTTGGAATGCAGAAGAGGTAAGG + Intergenic
948014894 2:234680403-234680425 AATGGTATAGAAGAGAGGAAAGG - Intergenic
1169384469 20:5136513-5136535 TAAGGATTCCAGGAGAGGTAAGG - Intronic
1169417318 20:5428431-5428453 TATGGTATCCATGAGTGTTACGG - Intergenic
1170346901 20:15397229-15397251 TACAGTATACATGAGATGTAAGG - Intronic
1173313742 20:41924849-41924871 GATGGGATACAGGAGAGAAATGG - Intergenic
1173577440 20:44122169-44122191 TATGGCATAGTGGAGAGGCAGGG - Intronic
1178391915 21:32205829-32205851 GATGGGAGAAAGGAGAGGTAAGG + Intergenic
1182833995 22:33326700-33326722 TATGGTGGAAAGGAGAGGAAGGG + Intronic
1183437515 22:37804411-37804433 TAGGGTATATGGGAGATGTAGGG + Intergenic
949550035 3:5104987-5105009 AATGGTATACCAAAGAGGTAGGG - Intergenic
949864820 3:8538796-8538818 TACGGTTTACAGGACAGGCAGGG - Intronic
950478594 3:13229980-13230002 TATGGTATACAGGAAATATGAGG + Intergenic
950797494 3:15521834-15521856 CATGGGAGACAGGAGAGGTGGGG - Intergenic
951639742 3:24823467-24823489 TATGGTATATAGGACAGTTTTGG - Intergenic
952707076 3:36390137-36390159 AGTGGTTTACAGGAGAGCTAAGG - Intronic
953623558 3:44552575-44552597 CAGGGTATACAGGAGAGTTCTGG + Intergenic
955581394 3:60426968-60426990 TATGTTATACAACAAAGGTAAGG + Intronic
955598126 3:60613854-60613876 GATGCTACACAGCAGAGGTAAGG + Intronic
956330463 3:68101197-68101219 TATGGGAAATAGGAGAGGTCAGG + Intronic
957541840 3:81581092-81581114 TATGTTATTAAGGAGAGGGAAGG + Intronic
960311575 3:116122870-116122892 TATGGTATCCATGAGAGACATGG + Intronic
960552767 3:118994884-118994906 ATTGGTAGACAGGAGAGGAATGG + Intronic
962000871 3:131295738-131295760 TATGTTAGAAAGGAGAGATAAGG - Intronic
962856110 3:139346319-139346341 TATGGTATACAGGAGAGGTACGG - Intronic
964638303 3:158881547-158881569 TATGGTACTCAGGAAAGATATGG - Intergenic
970249473 4:14098998-14099020 TATGGTATTCAGGGTAGGGAGGG + Intergenic
970695462 4:18671739-18671761 TATGGTATAAGGAAGAGGTGTGG + Intergenic
974250162 4:59375297-59375319 CATGTAATACAGGAGAGGTCAGG - Intergenic
975511261 4:75195404-75195426 TATCTCATACAGGAGAGCTATGG + Intergenic
976572848 4:86633319-86633341 TGAGGTAGACAGGAGAGGGAGGG - Intronic
978268652 4:106859887-106859909 TATGGTATGCAGTAGTGGTGGGG - Intergenic
980589504 4:134866818-134866840 TGTGGTATACAAAAGAGGTAAGG + Intergenic
980853648 4:138413086-138413108 TGTGGTCCACAGGAGAGGAACGG + Intergenic
983946431 4:173590900-173590922 TGTGCTGTGCAGGAGAGGTATGG - Intergenic
984508955 4:180655753-180655775 TATGATATACAGGGGAGATAAGG - Intergenic
984838619 4:184047437-184047459 TATGGCAAACAGGAGAGGAGAGG - Intergenic
985788757 5:1914003-1914025 TATAGTAAACAGGAGATCTATGG + Intergenic
988120397 5:26953914-26953936 TATAGTATACAGAAAAGCTATGG - Intronic
988227799 5:28435238-28435260 ACTGGTATATAGGTGAGGTAGGG + Intergenic
992836857 5:80650213-80650235 TTTGGTAAACAGGTGGGGTAAGG + Intronic
993464427 5:88227686-88227708 TATGATATACATGAGAAATATGG + Intronic
993563422 5:89441420-89441442 TAAAATATACAGGAGATGTATGG + Intergenic
996045305 5:118865885-118865907 TAAGGTCTACAAGAGAGGTAAGG - Intronic
996620418 5:125495114-125495136 AATGGTATAGAGGAGAAGTCTGG - Intergenic
1001714582 5:173804417-173804439 TAAAGTATACAGGAGAGGTTGGG - Intergenic
1005221920 6:23596902-23596924 CATGGTCTACAAGAGAGGTCAGG - Intergenic
1006021561 6:31120780-31120802 TACGGTAGGCAGGAGAGTTAAGG - Intronic
1009651405 6:66481222-66481244 TAAGGGATGCAGCAGAGGTAAGG - Intergenic
1010322687 6:74530994-74531016 TATGCTAAACAGGAGTGGTGAGG - Intergenic
1011104795 6:83767738-83767760 TATGGTCAACAGCAAAGGTAGGG - Intergenic
1011810952 6:91131609-91131631 TATGGTAAACATCAGAGGTGTGG + Intergenic
1014688230 6:124530469-124530491 AATGGGAGGCAGGAGAGGTAGGG + Intronic
1014843422 6:126246226-126246248 TATGGTAAACAGGAGGCTTATGG + Intergenic
1015217936 6:130771356-130771378 TGTGATATAAAGGGGAGGTACGG - Intergenic
1015915728 6:138214446-138214468 TATGCTATTCAGGAGGGATAAGG + Intronic
1017208921 6:151833687-151833709 TATGGTATACAGGTAAGGCAGGG + Intronic
1017385756 6:153880800-153880822 AATGGCCTACAGGAGAGGAAAGG + Intergenic
1018369504 6:163155090-163155112 TTTTGTATAGAAGAGAGGTATGG - Intronic
1020623017 7:10540855-10540877 CATGGTATAGATGAGAGATATGG - Intergenic
1021471407 7:21006409-21006431 TATGGGATACAGCAAATGTAGGG + Intergenic
1022198547 7:28093952-28093974 TATGGAATACTGAAGAGGGAGGG - Intronic
1026285582 7:68959901-68959923 TTTGGGATACAGAAGAGGAAAGG + Intergenic
1026838034 7:73651090-73651112 TATGTAAAACAGGAGAGGCAGGG + Intergenic
1030682619 7:112449939-112449961 AATGTTACCCAGGAGAGGTAAGG + Intronic
1031414418 7:121478583-121478605 TATAGTACAGAGGAGAGGTCAGG - Intergenic
1032780211 7:135159145-135159167 TATGGGAAACATGAGAAGTAAGG - Intronic
1032936423 7:136737958-136737980 TATGAAATACAGGAGAAGAAGGG - Intergenic
1035084744 7:156248403-156248425 TTTGGAATTCAGGAGAGCTACGG + Intergenic
1039422934 8:37459863-37459885 TATACTATACAGGAGAGAGATGG - Intergenic
1041618418 8:59935435-59935457 TATGGTGTACTGGTGAGGTCTGG - Intergenic
1043231527 8:77808277-77808299 TTTTGTATACAGGAGAGATAGGG - Intergenic
1044891013 8:96835602-96835624 TATGGTATAGTGAAGAGTTAGGG + Intronic
1045004139 8:97902726-97902748 CAAGGGAGACAGGAGAGGTAAGG - Intronic
1045075216 8:98558008-98558030 TATTGTGCACAGGAGATGTAAGG - Intronic
1045839724 8:106565088-106565110 TATGTTGTACAGGAGTGGTGAGG - Intronic
1046719357 8:117601576-117601598 GATGGTATACTGGAGGGATATGG - Intergenic
1050087506 9:1981212-1981234 TATGGCATACAGCAGAGATTTGG - Intergenic
1050748940 9:8913689-8913711 TTTGGAAGACAGGAAAGGTAAGG - Intronic
1052388915 9:27855546-27855568 TAAAGTGTACAGGAGAGTTAGGG - Intergenic
1056300497 9:85235167-85235189 TATGGGATGCAGAACAGGTATGG - Intergenic
1056981712 9:91318773-91318795 TTTGGAATGCAGGAGAGGCAAGG - Intronic
1060232114 9:121833134-121833156 TGTGGCATACAGGGCAGGTAGGG - Intronic
1061295581 9:129675153-129675175 TCCAGTATACAGGAGAGGGAGGG + Intronic
1188262596 X:28037579-28037601 AAGGGTACACAAGAGAGGTAGGG + Intergenic
1192475634 X:71439533-71439555 TATGGGAGACAGGAGTGGGAGGG - Intronic
1193392323 X:80943289-80943311 TATTATATTCAGGAGAGGCAAGG + Intergenic
1194870072 X:99118897-99118919 TATATTATACAGTAGAGGTGAGG + Intergenic
1197873076 X:131078475-131078497 CATGGTATACTGAAGGGGTAAGG + Intronic