ID: 962861741

View in Genome Browser
Species Human (GRCh38)
Location 3:139409555-139409577
Sequence CTGTGTATAAGGTGTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24057
Summary {0: 2, 1: 91, 2: 12933, 3: 7213, 4: 3818}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962861741_962861744 -8 Left 962861741 3:139409555-139409577 CCTTCCTTACACCTTATACACAG 0: 2
1: 91
2: 12933
3: 7213
4: 3818
Right 962861744 3:139409570-139409592 ATACACAGATTAATTCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962861741 Original CRISPR CTGTGTATAAGGTGTAAGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr