ID: 962863520

View in Genome Browser
Species Human (GRCh38)
Location 3:139426468-139426490
Sequence GTGAAGTAGCCAGAAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962863520_962863522 -3 Left 962863520 3:139426468-139426490 CCAGTGTTTTCTGGCTACTTCAC No data
Right 962863522 3:139426488-139426510 CACCGTGTTTCATGGCTCTCTGG No data
962863520_962863524 14 Left 962863520 3:139426468-139426490 CCAGTGTTTTCTGGCTACTTCAC No data
Right 962863524 3:139426505-139426527 CTCTGGAGTAGCCTCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962863520 Original CRISPR GTGAAGTAGCCAGAAAACAC TGG (reversed) Intergenic
No off target data available for this crispr