ID: 962865803

View in Genome Browser
Species Human (GRCh38)
Location 3:139447300-139447322
Sequence CACAGGAGGCGGCCCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962865803_962865812 -2 Left 962865803 3:139447300-139447322 CCTGTCAGGGGCCGCCTCCTGTG No data
Right 962865812 3:139447321-139447343 TGTGGAGGGCCTTAGGGCTCTGG No data
962865803_962865809 -9 Left 962865803 3:139447300-139447322 CCTGTCAGGGGCCGCCTCCTGTG No data
Right 962865809 3:139447314-139447336 CCTCCTGTGTGGAGGGCCTTAGG No data
962865803_962865810 -8 Left 962865803 3:139447300-139447322 CCTGTCAGGGGCCGCCTCCTGTG No data
Right 962865810 3:139447315-139447337 CTCCTGTGTGGAGGGCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962865803 Original CRISPR CACAGGAGGCGGCCCCTGAC AGG (reversed) Intergenic
No off target data available for this crispr