ID: 962865938

View in Genome Browser
Species Human (GRCh38)
Location 3:139448083-139448105
Sequence AGGAAGAAGAGAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962865938_962865948 23 Left 962865938 3:139448083-139448105 CCTTCCTCCTTTCTCTTCTTCCT No data
Right 962865948 3:139448129-139448151 GTAGCTCCCCTTATCCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962865938 Original CRISPR AGGAAGAAGAGAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr