ID: 962866788

View in Genome Browser
Species Human (GRCh38)
Location 3:139453718-139453740
Sequence TCCTCCTTCGAGGATCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962866788_962866792 -4 Left 962866788 3:139453718-139453740 CCTCACTGATCCTCGAAGGAGGA 0: 1
1: 0
2: 2
3: 10
4: 82
Right 962866792 3:139453737-139453759 AGGAGGGAAAAACATGAGTGTGG 0: 1
1: 0
2: 3
3: 33
4: 540
962866788_962866793 -3 Left 962866788 3:139453718-139453740 CCTCACTGATCCTCGAAGGAGGA 0: 1
1: 0
2: 2
3: 10
4: 82
Right 962866793 3:139453738-139453760 GGAGGGAAAAACATGAGTGTGGG 0: 1
1: 0
2: 4
3: 29
4: 333
962866788_962866794 1 Left 962866788 3:139453718-139453740 CCTCACTGATCCTCGAAGGAGGA 0: 1
1: 0
2: 2
3: 10
4: 82
Right 962866794 3:139453742-139453764 GGAAAAACATGAGTGTGGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962866788 Original CRISPR TCCTCCTTCGAGGATCAGTG AGG (reversed) Intronic
900562092 1:3312263-3312285 TCCTCCTCAGAGGATGAGCGTGG - Intronic
900843086 1:5071472-5071494 TCCTCCTTCCTGGCTCTGTGGGG + Intergenic
901241482 1:7696642-7696664 TCCTCTTTGAAGGCTCAGTGGGG + Intronic
904309998 1:29622730-29622752 TCCTATTTCCAGGGTCAGTGGGG - Intergenic
906667973 1:47635060-47635082 GCCTTCTTCCAGGATCAGTGGGG + Intergenic
906791726 1:48664398-48664420 TTCTCCTTGGATGATCAGTGAGG - Intronic
911192343 1:94960422-94960444 TCCTCCTTCTAGAATCAGGGAGG - Intergenic
911328811 1:96501655-96501677 GCCTCCTTCAAAGATCACTGTGG - Intergenic
912324563 1:108745611-108745633 TGTTGCTTTGAGGATCAGTGAGG + Intergenic
915619266 1:157069829-157069851 TCCAGCTGCGAGGATTAGTGAGG - Intergenic
915938271 1:160101492-160101514 TCCTCCTTCGTGTCTCAGTCTGG - Intergenic
917301847 1:173583052-173583074 TCCTCCTTCGGGTATCCATGGGG + Intronic
917849039 1:179044176-179044198 GCCTCCTTCAAGTATCAGTAAGG - Exonic
920181415 1:204134287-204134309 ACCTCCTACGAGGAACAGGGAGG + Intronic
920964040 1:210687563-210687585 TCTTCCTTTGAGAATCAGAGGGG + Intronic
921358867 1:214312257-214312279 TCCTTCTTGGGGGATCAGTGTGG + Intronic
1062986527 10:1774081-1774103 CCCTCCTTCCCGGATGAGTGAGG + Intergenic
1063555210 10:7072330-7072352 TCTTCCTTGGATGTTCAGTGTGG - Intergenic
1075015950 10:118910104-118910126 TCCTCCTTGGAGGCTCTTTGTGG - Intergenic
1076479576 10:130776107-130776129 TCCTCCTCCAAGGATCAGTGTGG - Intergenic
1078648124 11:13161177-13161199 TCTTCTTTCCAGGGTCAGTGAGG + Intergenic
1080240918 11:30126301-30126323 TCTTCCTCCCAGGATCAGAGTGG + Intergenic
1085326317 11:75609425-75609447 CCCTCCTTCGGGGCTCAGAGAGG + Intronic
1088145425 11:106670996-106671018 AACTCCATCAAGGATCAGTGGGG - Intergenic
1088914700 11:114218427-114218449 TGCTCATTCTAGGATCAGTGTGG - Intronic
1089314351 11:117581104-117581126 TCCTCCTTTGAGGAGCACTGTGG + Intronic
1091666573 12:2423016-2423038 TCCTCCATCGAGGATTAGCTTGG + Intronic
1093250092 12:16792262-16792284 TCCCCCTTCTGGGATCAGAGGGG - Intergenic
1093574238 12:20708379-20708401 TCCTCCTCAGAAGATCTGTGAGG - Intronic
1101753041 12:107598944-107598966 TCCTCCTTCCTGGATAAGTCTGG + Intronic
1112643276 13:101301357-101301379 TCTGCCTTTGAGGAGCAGTGAGG + Intronic
1112926339 13:104679650-104679672 TGCTCCTTGGAGGATCCCTGTGG - Intergenic
1113394798 13:109937209-109937231 TCCTTCTTCGAGGTTCCATGTGG + Intergenic
1115370441 14:32607976-32607998 TACTTCTTTGAAGATCAGTGTGG + Intronic
1119635207 14:76267912-76267934 TCCTCCTGCGCGGATCGTTGTGG + Intergenic
1121654054 14:95582072-95582094 TCCTACTATGAGGAGCAGTGAGG - Intergenic
1132620786 16:867504-867526 TCGTCCTTCGAGGCTCAATACGG - Intronic
1132846630 16:2003815-2003837 TCCTTCTTAGAGGGTCTGTGAGG - Intronic
1140645149 16:77021841-77021863 TTCTCCATCAAGGATCAGTTGGG - Intergenic
1141780762 16:86159131-86159153 TCCTCCCTGGAAGATCAGGGGGG + Intergenic
1142407895 16:89901354-89901376 GCCTCCTCCGAGGAGCTGTGAGG + Intronic
1143314665 17:6023215-6023237 TGCTCCTGCAAAGATCAGTGTGG + Intronic
1150311844 17:64135400-64135422 TCCTCCTTCCAGATTCTGTGTGG + Intergenic
1151194819 17:72423983-72424005 TCCTGCCTGGAGGATCATTGTGG + Intergenic
1151875938 17:76868412-76868434 GCCTCCTCCGAGGAACAATGCGG + Intergenic
1159023542 18:63162725-63162747 TCTTCCTTGGAGGAGCAGTGAGG - Intronic
1160914604 19:1490675-1490697 CCCTCCTTCGAGAATCAGCCCGG + Intronic
1167571525 19:50292054-50292076 TCCTCCCTTGAGGACCAGAGTGG + Intronic
928102775 2:28449189-28449211 GCCACCTTCGAGGATCAATGGGG + Intergenic
929899261 2:45987160-45987182 TCCTTCTTCCAGGGTCATTGGGG - Intronic
929992148 2:46799519-46799541 TGCTCCTCTGAGGATCAGAGAGG - Intergenic
930000739 2:46859980-46860002 TCCTCCTTCTGGGGTCACTGAGG - Intergenic
934547956 2:95234423-95234445 TCCTTCTTCCAGGGTGAGTGAGG - Intronic
939286758 2:140141105-140141127 TCTGCCTTCCAGGACCAGTGGGG - Intergenic
941257170 2:163246452-163246474 TTCTCTTTCCAGGATAAGTGTGG + Intergenic
1170575764 20:17660205-17660227 TCCTCCTTCGAGAACCAGTGCGG - Exonic
1171226012 20:23442720-23442742 TCTTCCTCCCAGGAGCAGTGTGG + Intronic
1178083914 21:29093910-29093932 CCCTCCTTCTAGGATTACTGTGG + Intronic
1178223183 21:30684265-30684287 TCTTCCTGCAAGTATCAGTGAGG - Intergenic
1179519756 21:41934586-41934608 TTCTACTTCTAGGAACAGTGAGG + Intronic
1183727949 22:39599867-39599889 TCCTGTTTCCAGGATTAGTGAGG - Intronic
1184660419 22:45963093-45963115 TCCTCCTTCCAGGAACAGATGGG + Intronic
951799739 3:26582543-26582565 TGCTCCTTCGTGTATCACTGGGG + Intergenic
958019602 3:87980132-87980154 TCCTGCTTCAAGGAAGAGTGAGG + Intergenic
962866788 3:139453718-139453740 TCCTCCTTCGAGGATCAGTGAGG - Intronic
963325264 3:143855591-143855613 TCCTCCTTCGTGGACCACTGTGG + Intergenic
966898737 3:184465236-184465258 TCCTGTTTCCAGGATCTGTGAGG + Intronic
967756550 3:193176639-193176661 TCTTCCTTTGAGAATCAGAGGGG + Intergenic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
975829544 4:78354938-78354960 CTCTGCTTCAAGGATCAGTGAGG - Intronic
985100633 4:186454732-186454754 TCCTCCCTATAGGAACAGTGCGG + Intronic
993750827 5:91665355-91665377 TCATCCTCTGAGGATCAGTGGGG + Intergenic
996560720 5:124826113-124826135 TACTCTTTTGAGAATCAGTGAGG - Intergenic
1011049779 6:83132271-83132293 TCCTTCTTCTAGCATCTGTGAGG + Exonic
1015286173 6:131488935-131488957 TCCTTCTTATAGGTTCAGTGTGG - Intergenic
1019538674 7:1541722-1541744 TCCTCCTTCCAAGAGCACTGAGG + Exonic
1020572445 7:9883038-9883060 TCCTCCTTAGGGGATAAATGTGG + Intergenic
1022492197 7:30829660-30829682 TGCTACTTCTAGGATCAGTTAGG - Intronic
1026694102 7:72575412-72575434 TCGTCCTTGGAGAATCAGAGTGG + Exonic
1027268016 7:76504616-76504638 TCCTCCCTCGAGGCTATGTGAGG - Intronic
1027319827 7:77004478-77004500 TCCTCCCTCGAGGCTATGTGAGG - Intergenic
1038276483 8:26125717-26125739 TTCTCCTTCAAGCAACAGTGAGG - Intergenic
1039655454 8:39400008-39400030 TCTTCCTTCCAGGCTCACTGAGG + Intergenic
1041294598 8:56342015-56342037 TCCTGCTTCTTGGATCAGAGAGG + Intergenic
1044610062 8:94082488-94082510 TCATCCTTCTTGGATCCGTGTGG + Intergenic
1049348594 8:142152201-142152223 GCCTGCTTCAAGGACCAGTGAGG + Intergenic
1050096353 9:2071151-2071173 ACCTACTTGGAGGATCAGAGTGG + Intronic
1060060972 9:120459225-120459247 TCCACCTTCTTGGATCACTGAGG + Intronic
1060375126 9:123110374-123110396 TCGTACTTCCAGGAACAGTGAGG - Intronic
1060768401 9:126312241-126312263 GCCTCCTTCAAGGGCCAGTGTGG + Intergenic
1061321353 9:129831963-129831985 CTCTCCCTCCAGGATCAGTGAGG - Exonic
1185952269 X:4450335-4450357 TCCTCCTTCCAAGTTCACTGAGG + Intergenic
1187626931 X:21125370-21125392 TCCTCCTTTGATGTTTAGTGTGG + Intergenic
1193945440 X:87728147-87728169 TCCTCCTCCCAGCATCAGGGAGG - Intergenic
1199573435 X:149290439-149290461 TCCTCCTTTGAGGAACAGCATGG + Intergenic