ID: 962869822

View in Genome Browser
Species Human (GRCh38)
Location 3:139478072-139478094
Sequence GGGTTTTCATGGGCATTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962869822 Original CRISPR GGGTTTTCATGGGCATTGAG GGG Intronic
900724496 1:4207023-4207045 GGGTTTTCATGGACATTTTTGGG + Intergenic
901550016 1:9989152-9989174 GGGTTTTCATGGGCACAGGATGG - Intergenic
904036246 1:27560544-27560566 GGGTTTTCAGGGTCATGGTGTGG + Intronic
905586934 1:39127438-39127460 GGGTTATCATGAGAATTAAGTGG - Intronic
906709703 1:47920130-47920152 GGGTTTTCCTGAGGATCGAGTGG + Intronic
910301529 1:85711969-85711991 GGATTTTCATAGGGATTGTGTGG + Intergenic
911167010 1:94733205-94733227 GGTTTTCCATGGGCAGAGAGGGG - Intergenic
915846242 1:159268588-159268610 GGGTTTTCAGGAGTACTGAGGGG - Intergenic
915906203 1:159879182-159879204 GGGGTGTCTTGGACATTGAGTGG - Intronic
916193301 1:162199488-162199510 GTGTTATCATGGGCTTTTAGTGG + Intronic
921686332 1:218093234-218093256 GGGTTTTGATGAGCTTAGAGTGG - Intergenic
921956016 1:220983860-220983882 GGGTTTTCATAGGCACAGAATGG - Intergenic
921958141 1:221005293-221005315 GAGTTTTGATAGCCATTGAGTGG - Intergenic
921985664 1:221309175-221309197 GGGTTTTTATGGGCTTAGAATGG + Intergenic
923786205 1:237071531-237071553 GGGTTTTTATGGGCTCAGAGGGG + Intronic
1063885196 10:10570148-10570170 GGGTCTACAAGGGCATTGAGGGG + Intergenic
1069356454 10:67592147-67592169 GGGTTTTTATGGGCTTAGAATGG - Intronic
1072816189 10:98511802-98511824 TGGTTTTCCTGGGCACTGACAGG + Intronic
1073211029 10:101802704-101802726 GCATGTTCATGGGCACTGAGGGG - Intronic
1073520880 10:104127801-104127823 GGGATTTCCAGGGCATTGACTGG + Intergenic
1074500162 10:114016612-114016634 GGGTTGTCATGAGCCTTAAGTGG - Intergenic
1075344606 10:121673092-121673114 GGGGTTTCTCGGGCACTGAGAGG - Intergenic
1075988200 10:126806768-126806790 GGGCTTTCATGAGGATTAAGTGG + Intergenic
1079466945 11:20740139-20740161 GGGTTGTTATAAGCATTGAGTGG - Intronic
1081490685 11:43566157-43566179 GAGTTGTCATTAGCATTGAGTGG + Intronic
1081620952 11:44618956-44618978 AGGTTTACATGGGGATTAAGTGG - Intronic
1084242739 11:67833643-67833665 GGGTTTTTATAGGCATAGAATGG + Intergenic
1086461185 11:87007323-87007345 GTGGTTTCATGAGAATTGAGTGG + Intergenic
1087991231 11:104746899-104746921 GGGTTTTTATGGGCACAGAATGG - Intergenic
1089621650 11:119726160-119726182 GGGTTTTCCTGGGCTGTGACAGG - Intronic
1092412975 12:8268343-8268365 GGGTTTTCATAGGCACAGAATGG + Intergenic
1093656016 12:21694932-21694954 GGGTTTTCATAGGCATAGGATGG + Intronic
1093770166 12:23008956-23008978 GTGTTTTCATGAGAATTGAGAGG + Intergenic
1094654132 12:32404621-32404643 AGGTTTTCCAGGGCTTTGAGTGG + Intronic
1097231213 12:57512380-57512402 GGGTGTTCATAGGAAATGAGGGG + Intronic
1099670122 12:85680738-85680760 GGGTTTTTATGGGCTTAGAATGG - Intergenic
1099729251 12:86477362-86477384 GAGTTCTCATGGGCATAAAGAGG + Intronic
1100223703 12:92534864-92534886 GGGATTTCAGGGGCATTCAGCGG + Intergenic
1100553711 12:95671882-95671904 TGCATTTCATAGGCATTGAGTGG + Intronic
1101317105 12:103639330-103639352 GGGCTTTCTTGTGCATTGTGAGG + Intronic
1101402960 12:104404255-104404277 TGGCTTTCATGGGCATTGGCAGG - Intergenic
1101663027 12:106783752-106783774 GGATTTTCCTGGGCAGTTAGTGG + Intronic
1102956911 12:117064873-117064895 GGGTTGTCCTGGGCACTGTGGGG - Intronic
1103229168 12:119313745-119313767 GAGCTTACATGGGCATGGAGGGG - Intergenic
1103230969 12:119330175-119330197 GAGTTTCCATGGGCATAGAGGGG - Intergenic
1103710673 12:122910220-122910242 GGGTTTTCAATGGCATGGATGGG + Intergenic
1105587291 13:21756918-21756940 GGGTTTTTATGGGTTTTGAATGG - Intergenic
1106228757 13:27805497-27805519 GGGCTTTCATGAGGATTAAGAGG - Intergenic
1107115407 13:36741040-36741062 GGTTTTTCAGGGGCTTGGAGTGG - Intergenic
1108587541 13:51883513-51883535 GGGTTTTTATGGGCTTAGAAGGG + Intergenic
1109413014 13:61998788-61998810 GGGTTTTTATGGGCTTAGAATGG + Intergenic
1109521065 13:63511552-63511574 GGGTTTTCATGGGCTCAGAATGG - Intergenic
1110095665 13:71516699-71516721 GCGTTTTGATGGGCAGGGAGCGG - Intronic
1111922315 13:94425211-94425233 GGGTTTTAATGGGGAGTGACAGG + Intergenic
1112069573 13:95834404-95834426 GGGTTTTCCTGTGCATTGTTGGG - Intronic
1112720575 13:102239688-102239710 AGGTTTTCTTGGTCATTTAGTGG - Intronic
1112809319 13:103199404-103199426 GGGTTTTTATGGGCTTAGAATGG + Intergenic
1116085427 14:40231226-40231248 GGGTTTTTATGGGCTTAGAATGG + Intergenic
1117823286 14:59673589-59673611 GGGTTTTTATGGGCTTAGAATGG + Intronic
1117921915 14:60733782-60733804 GGATTTCCATGGGTATAGAGAGG - Intergenic
1118251983 14:64170677-64170699 GGGTTCTCTTGGGCCATGAGAGG + Intronic
1118464700 14:66020459-66020481 GGGTTTTTATGGCCATGGTGGGG + Intergenic
1119285713 14:73452567-73452589 GGGTTTTCGTGGGTAGAGAGGGG + Intronic
1120367966 14:83594513-83594535 GAGTTTTCATGGGCTTAGAATGG - Intergenic
1127765139 15:62178608-62178630 GGGTGATCATGGGCTTGGAGAGG - Intergenic
1128991826 15:72267274-72267296 GGGTTTTCTTGGGGAGGGAGAGG - Intronic
1129020309 15:72511020-72511042 GGAGTTTGATTGGCATTGAGTGG + Intronic
1131539668 15:93265735-93265757 TGGTTTTCATGGGCAGTTATGGG + Intergenic
1131691220 15:94830187-94830209 GGGTTTTCATGGGCTCAGAATGG - Intergenic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132597488 16:760053-760075 GGGGTTTCAGGGGCAGGGAGGGG + Intronic
1133277244 16:4646462-4646484 GGGCTTGCCTGGGCATGGAGGGG + Intronic
1134810751 16:17165211-17165233 GGGTTGTCATGAGGATTAAGTGG - Intronic
1135969303 16:27060742-27060764 GGGATTGCATGGGGAATGAGAGG - Intergenic
1136871593 16:33812414-33812436 GGTCTTGCATGGGCACTGAGTGG - Intergenic
1138160924 16:54753503-54753525 AGGTGTTCATGTGCAATGAGAGG - Intergenic
1138394815 16:56695721-56695743 GGGCTTTTATGGGCCTTGAAGGG - Intronic
1138455676 16:57119367-57119389 GGGTTTTCCTGCACACTGAGCGG - Intronic
1138521361 16:57573051-57573073 GGGTTGTCATGGGGATTGCAGGG + Intronic
1138736925 16:59261473-59261495 GAGATTTCATGGGCACTGAGTGG + Intergenic
1139649066 16:68353014-68353036 TGGTTTTCATGGCCAAAGAGGGG + Intronic
1140051237 16:71483188-71483210 TGGTTTTCATGGCCCTTGAGTGG - Intronic
1140853094 16:78952967-78952989 GATTTTTCATGAGCATTGTGTGG - Intronic
1141232757 16:82185425-82185447 GGGTTTCCATCAGCCTTGAGAGG + Intergenic
1203100579 16_KI270728v1_random:1303644-1303666 GGTCTTGCATGGGCACTGAGTGG + Intergenic
1149017147 17:51921267-51921289 GAGTTCTGATGGGCACTGAGGGG - Intronic
1150838414 17:68585606-68585628 GGCTTTTCACTGACATTGAGTGG - Intronic
1151966113 17:77432647-77432669 GGGTTTTTGTGGGGACTGAGCGG + Intronic
1152872999 17:82768308-82768330 TGGCTTTCATAGGCATTGGGTGG + Intronic
1153132033 18:1865454-1865476 GGGTTTTTATGGGCTTAGAATGG - Intergenic
1153256415 18:3176096-3176118 GGGTTTGCATGGACATTTATTGG + Exonic
1153696434 18:7647478-7647500 TGTATTTCATGGGCAGTGAGAGG + Intronic
1155837894 18:30610108-30610130 TGGTATTCATTTGCATTGAGGGG + Intergenic
1157199415 18:45646464-45646486 GGATTTTCTAGGGCAATGAGTGG - Intronic
1157615145 18:48982437-48982459 GGGATTTCCTGGGCAGTTAGCGG - Intergenic
1159161337 18:64646677-64646699 GGGTTTTTATGGGCTTAGAAGGG + Intergenic
1159668005 18:71187567-71187589 AGGTTTTCTTAGGCATTAAGAGG + Intergenic
1160007271 18:75076633-75076655 AGGTGTTCATGGGAATAGAGTGG - Intergenic
1160590095 18:79939299-79939321 GGGGGATCATGGGCCTTGAGAGG - Intronic
1161219257 19:3110523-3110545 GAGTTGTGATGGGCATTGCGTGG + Intronic
1161328613 19:3675702-3675724 TGGTTTGCATGGGCTTTGGGGGG - Intronic
1161520426 19:4720726-4720748 GGGTTATCCTGGGCACTGTGGGG - Intronic
1162057042 19:8071062-8071084 GGGTTGTCATAAACATTGAGAGG + Intronic
1162207391 19:9065885-9065907 AGGGCTCCATGGGCATTGAGGGG + Intergenic
1165135564 19:33666248-33666270 GGGCTTCCACGGGCATGGAGGGG - Intronic
1165300823 19:34967665-34967687 GGGTTTTTATGGGCATAGGATGG - Intergenic
925280413 2:2680537-2680559 GGGTTTTAATTGGCATTTAGAGG - Intergenic
926488359 2:13491810-13491832 GGGTTTGCATGGTGATTGATGGG - Intergenic
926892639 2:17651142-17651164 GGGTTTTGGTGGCCAATGAGGGG - Intronic
927371099 2:22356055-22356077 GGGTCTTCATTGGAGTTGAGTGG - Intergenic
928677788 2:33666755-33666777 GGGTTTTCATAGGCACAGAATGG - Intergenic
930027160 2:47036022-47036044 GCCTTTTCATGGCCATTCAGGGG - Intronic
932659972 2:73643270-73643292 GGGAGTTCAGGGGGATTGAGAGG + Intergenic
932666540 2:73702929-73702951 GGGAGTTCAGGGGGATTGAGAGG + Intergenic
932825645 2:74936943-74936965 GGGTTTTCAACTGCATGGAGGGG - Intergenic
933097392 2:78203711-78203733 GGGTTTTCATGGGCAAGCAAGGG + Intergenic
933165613 2:79071482-79071504 AGGATTTCATGGGAATTAAGTGG - Intergenic
933168948 2:79104081-79104103 AGGTTTTCATGGGGATTAAATGG - Intergenic
933243911 2:79953732-79953754 GGGTTATCATGTGGATTGAAGGG + Intronic
933996924 2:87676907-87676929 GGTTGTTCATGGACATTCAGTGG + Intergenic
934490702 2:94760545-94760567 GGGCTTCCATGGGAATTGGGAGG - Intergenic
936296926 2:111274003-111274025 GGTTGTTCATGGACATTCAGTGG - Intergenic
936445395 2:112590731-112590753 GTATTTTCATGGGCATTGACTGG + Intergenic
943858438 2:192828513-192828535 GGGTTTTTATGGGGGTTCAGAGG - Intergenic
943906556 2:193506342-193506364 GGGTTTTCATAGGCATAGGATGG + Intergenic
944374440 2:199025510-199025532 GCTTTTTCATGTACATTGAGAGG - Intergenic
945726522 2:213477018-213477040 GGGTTTTTATGGGCTTAGAATGG + Intronic
946471384 2:219964245-219964267 GGGTTTTTATGGGCATAGGATGG - Intergenic
946792049 2:223310814-223310836 GGTTTTTCATTAGCACTGAGAGG + Intergenic
947353867 2:229272403-229272425 GGGTTTCCATGGTCAGTTAGAGG - Intergenic
947900092 2:233714037-233714059 GGGTTTCAATGGCCACTGAGAGG + Intronic
948341306 2:237254433-237254455 GGGTTGTCATGAGAATTTAGTGG + Intergenic
948434547 2:237944231-237944253 GGGTTTTTATGGGCTTAGAAGGG - Intergenic
948694862 2:239728098-239728120 TGATTTTCAAGGGCAATGAGTGG + Intergenic
1173921535 20:46749933-46749955 GTGTTTGAATGGGCAGTGAGAGG - Intergenic
1175475366 20:59269501-59269523 GTGGTTTCATGTGCAGTGAGAGG + Intergenic
1175815976 20:61883469-61883491 GGGGTGTCCTGGGCACTGAGGGG - Intronic
1179036484 21:37762811-37762833 GGGATTTCATTGGCTTGGAGTGG - Intronic
1180623998 22:17181870-17181892 AGGTCTTCATGGGCATTGGGGGG - Exonic
1182067578 22:27441663-27441685 GGGTTTTGAGGGGGATGGAGTGG - Intergenic
1184859918 22:47167690-47167712 GGGTTTTTATGGGCTTTGAATGG + Intronic
949307927 3:2663971-2663993 TTGTTTTCTGGGGCATTGAGAGG + Intronic
949444095 3:4115065-4115087 GGGTTTTCATAGGCACAGAGTGG - Intronic
949708023 3:6841259-6841281 TGGTCTTCTTGTGCATTGAGTGG - Intronic
951054455 3:18131757-18131779 GGGTCTTGAGGGCCATTGAGTGG - Intronic
951218778 3:20047904-20047926 AGGTATTCATGGGCCTTGTGTGG - Intronic
952395544 3:32917563-32917585 GGGTTTTTATGGGCTTAGAATGG + Intergenic
954278122 3:49555318-49555340 GGCTTTCCTTGGGCATTTAGTGG + Intronic
955044876 3:55350357-55350379 GGGTTGAGATGGTCATTGAGAGG + Intergenic
955111880 3:55958329-55958351 GGGTTTTCATGGGCTCAGAAGGG + Intronic
955904357 3:63791005-63791027 GGGCTTTCATATTCATTGAGTGG + Intergenic
956720721 3:72115187-72115209 GAGTTTCCATTGGCATTTAGCGG + Intergenic
957029311 3:75221614-75221636 GGGTTTTTATGGGCACAGAATGG + Intergenic
957156499 3:76551152-76551174 GGGTTTTCATGGGCTCAGAAGGG - Intronic
957417905 3:79929670-79929692 GGGTTTTTATGGGCTCTGAAGGG - Intergenic
957614069 3:82505891-82505913 GGGTTTTTATGGGCTCAGAGGGG - Intergenic
958446514 3:94222201-94222223 GGGTTTTTATGGGCTTTGAATGG - Intergenic
961109949 3:124275538-124275560 GGGTTGTTATGAGAATTGAGTGG + Intronic
962869822 3:139478072-139478094 GGGTTTTCATGGGCATTGAGGGG + Intronic
966254195 3:177899078-177899100 GGGTTTTCATGGGCTCAGAATGG - Intergenic
966365047 3:179176329-179176351 GGGGTTTCATGAGAATTGACTGG + Intronic
967460876 3:189744458-189744480 TGGTGTTCCTGGGCACTGAGGGG - Intronic
967519647 3:190414948-190414970 GGGTTTTTATGGGCTTTGAATGG + Intergenic
967597354 3:191342583-191342605 GGGTTTTAATGGGCATGGCTGGG + Intronic
967631306 3:191745359-191745381 GGGATTTCCTGGGACTTGAGTGG - Intergenic
971127966 4:23775190-23775212 GGGTTTTCAAGGGAATTGGGAGG - Intronic
972518764 4:39833887-39833909 GGGTTTTAACAGCCATTGAGTGG - Intronic
973002117 4:44963728-44963750 GGGTTTTTATGGGCTTAGAATGG + Intergenic
974796133 4:66752651-66752673 GGATTTTCATTGACATTGAATGG - Intergenic
975315385 4:72946116-72946138 GGGTTTTTATGGGCTTAGAATGG + Intergenic
975318048 4:72977991-72978013 GGGTTTTATTGGACACTGAGAGG + Intergenic
977384965 4:96327161-96327183 GGGTGTTCATGGACATGGAAAGG + Intergenic
978247474 4:106591740-106591762 GGGTCTTCAAGAGCAGTGAGAGG - Intergenic
980330812 4:131408851-131408873 GGGTTTTTATAGGCACAGAGTGG + Intergenic
980823587 4:138047202-138047224 GGGTTTTCATAGGCACAGGGTGG - Intergenic
982837027 4:160131521-160131543 GGGTTCTCATGGGTAGAGAGAGG - Intergenic
983320397 4:166189763-166189785 GGGTTTTTATGGGCTTAGAATGG + Intergenic
983717634 4:170805056-170805078 GGGTTTTTATAGGCACAGAGTGG - Intergenic
983987203 4:174073721-174073743 GGGTTTTTATGGGCACAGAATGG + Intergenic
985239278 4:187912745-187912767 GGTTTTTCTAGGGAATTGAGAGG + Intergenic
986399538 5:7367718-7367740 GGGTGTCCATGTGCCTTGAGAGG + Intergenic
986637382 5:9836414-9836436 GGGCTGTCATGTGCATTGTGGGG + Intergenic
987312809 5:16697153-16697175 GGGGTTTCATGAGCACTGTGGGG + Intronic
987928145 5:24367596-24367618 GGGTTTTTATGGGCTTAGATTGG + Intergenic
987928641 5:24374392-24374414 GGGTTTTTATGGGCTTAGATTGG + Intergenic
988990489 5:36665656-36665678 GGGTTTTCACTGGCATTAAAGGG - Intronic
990335242 5:54765971-54765993 GGGTTTTTATGGGGACTGAATGG - Intergenic
990873816 5:60462305-60462327 GGGTGTTCATGGGCAGCTAGTGG + Intronic
991970918 5:72140993-72141015 GGGTATCCATGGGCAATGAGTGG - Intronic
993835718 5:92817919-92817941 GGGTTTTCATGGGTTTAGAATGG - Intergenic
996398082 5:123033088-123033110 AAGTTTCCATGGCCATTGAGTGG - Intronic
999714858 5:154352488-154352510 GGGTTTTCATGGGCAAAATGGGG - Intronic
1001094149 5:168763092-168763114 GGATTTTCATGAACATTTAGAGG - Intronic
1001284095 5:170409858-170409880 GGGTTGTCATGAGCATTCAAGGG + Intronic
1001651513 5:173319309-173319331 GGGTTTTAAAGGCCAGTGAGAGG - Intronic
1001827374 5:174756271-174756293 GGATTTAAATGGGAATTGAGTGG - Intergenic
1003786644 6:9494211-9494233 CACTTTTCAGGGGCATTGAGGGG - Intergenic
1005987955 6:30885742-30885764 GGGTTGTCAGGGACACTGAGAGG + Intronic
1006040674 6:31251907-31251929 GGGCATTGATGGGCACTGAGGGG - Intergenic
1007224361 6:40302453-40302475 GAGGTATGATGGGCATTGAGTGG - Intergenic
1010504034 6:76634037-76634059 GGGTTTTTATAGGCACGGAGTGG + Intergenic
1010648151 6:78419115-78419137 GGAATTTTATGAGCATTGAGGGG + Intergenic
1012662696 6:101922279-101922301 GGGATTCCATGGGAAATGAGAGG - Intronic
1013864624 6:114680230-114680252 GGGTTTTTATGGGCTTAGAATGG + Intergenic
1014502002 6:122203141-122203163 GGTTTTTTATGGGCATAGAATGG + Intergenic
1014684424 6:124477920-124477942 GGATATTCATTGGCATTGACAGG - Intronic
1016163307 6:140908137-140908159 GGGTTTTTATGGGCTCAGAGGGG + Intergenic
1016210846 6:141531676-141531698 GGGTTTTTATGGGCTCTGAAGGG - Intergenic
1016222999 6:141698875-141698897 GGGTTTTCATGGGATTGGAATGG - Intergenic
1016548977 6:145255722-145255744 GGGTTTTTATGGGCATAGGATGG + Intergenic
1018291906 6:162299713-162299735 GTGTTTTCATGGCCATACAGTGG + Intronic
1021787445 7:24165575-24165597 GGGTTTTTATGGGCTTAGAATGG + Intergenic
1023615556 7:42016098-42016120 GGGTTGTCCTGGGCATTGTAGGG - Intronic
1024441095 7:49418530-49418552 GGGTTTTCATGGAAATTTATAGG + Intergenic
1024828697 7:53422312-53422334 GGGTTTTAATGGGCTTAGAATGG - Intergenic
1027995475 7:85420941-85420963 GGGCTCTCATAGGCGTTGAGTGG + Intergenic
1028345759 7:89779984-89780006 GGGTTTTTATAGGCATAGGGTGG - Intergenic
1028433159 7:90771568-90771590 GGGTTTTTATGGGCTTAGAATGG + Intronic
1030755744 7:113285763-113285785 GGGTTTTTATGGGCTTAGAATGG + Intergenic
1031870781 7:127088301-127088323 GGGCCTTCATGGTTATTGAGAGG - Intronic
1032450869 7:132029770-132029792 GGGTTTTCAAGGGCATGGCTGGG + Intergenic
1034252165 7:149701398-149701420 GGGTTTTCATGGGCTCAGAAGGG + Intergenic
1034430090 7:151036809-151036831 GGGTTGTTATGGGCCCTGAGGGG - Intronic
1034571355 7:151958938-151958960 GGGTTTTCATGGGCTCAGAATGG + Intronic
1034637300 7:152577416-152577438 GGGTTTTTATGGGCAATTATTGG + Intergenic
1037062412 8:14531224-14531246 GGGTTTTTATGGGCTTAGAATGG - Intronic
1038534880 8:28346790-28346812 GGGTTGTCTTGGGAAGTGAGGGG + Exonic
1041467136 8:58168105-58168127 GGGTTTTTTGGGGGATTGAGAGG - Intronic
1044172505 8:89072220-89072242 AGATCTGCATGGGCATTGAGTGG + Intergenic
1044206167 8:89494120-89494142 GGGTTTTTATGGGCACAGGGTGG - Intergenic
1045873382 8:106950468-106950490 GGGTTTTTATGGGCTCTGATGGG - Intergenic
1046632920 8:116639565-116639587 AGGTCTTCATGTGCATTAAGGGG - Intergenic
1046657141 8:116907062-116907084 GGGCTTTCACAGGCATGGAGAGG + Intergenic
1047075283 8:121394176-121394198 GGGTTTTCCTTGGAGTTGAGAGG + Intergenic
1047769035 8:128015801-128015823 GGGTTTTCCTGGTCATTAGGTGG + Intergenic
1047878800 8:129170097-129170119 GGGTTTTTATGGGCACAGGGTGG - Intergenic
1048114389 8:131505365-131505387 GGGTTCTTTTGGGGATTGAGTGG + Intergenic
1049196772 8:141320199-141320221 GGGTCTTCATGGGCTCTGAGGGG + Intergenic
1049563217 8:143323807-143323829 GGGTGTGCATGTGCATTGTGTGG - Intronic
1049799897 8:144512896-144512918 GGGTCTGCATGGGCCATGAGCGG - Exonic
1052033577 9:23656008-23656030 GGGTTGTCATGGGCATTGTAGGG - Intergenic
1052881418 9:33602977-33602999 GGCTTTCCATGGGAATTGGGAGG + Intergenic
1053583958 9:39436705-39436727 GGGTTTTTATGGGCACAGAATGG + Intergenic
1053667291 9:40325149-40325171 GGGCTTCCATGGGAATTGGGAGG + Intronic
1053916872 9:42950254-42950276 GGGCTTCCATGGGAATTGGGAGG + Intergenic
1054105539 9:60995449-60995471 GGGTTTTTATGGGCACAGAATGG + Intergenic
1054378436 9:64465177-64465199 GGGCTTCCATGGGAATTGGGAGG + Intergenic
1054517319 9:66051134-66051156 GGGCTTCCATGGGAATTGGGAGG - Intergenic
1055129707 9:72760873-72760895 GCGCTTTCATGGGTATGGAGAGG - Intronic
1056028344 9:82524676-82524698 TGGTTTTCAGGAGCATTGTGGGG + Intergenic
1062107626 9:134764336-134764358 GGGGGTTCAAGGGCATTGTGGGG + Intronic
1186459840 X:9739553-9739575 GGGTTTTCATGGGGCATCAGTGG + Exonic
1189187530 X:39066945-39066967 TGGTTTTCAGAGGCATGGAGAGG + Intergenic
1189366431 X:40392530-40392552 GGTTTGTCATGGGCCTGGAGAGG + Intergenic
1189954477 X:46263454-46263476 GGGTTTTCATGGGCACAGGATGG + Intergenic
1190621119 X:52287912-52287934 GGGTTTTTATGGGCTTAGAAGGG - Intergenic
1191786555 X:64922613-64922635 GGACTTTCCTGGGCATTGAGAGG - Intronic
1191818055 X:65270834-65270856 GGGTCTTCATGGGCTTGGAAAGG - Intergenic
1194082240 X:89483267-89483289 GGGTTTTTATGGGCTTTCAATGG + Intergenic
1195633169 X:107081557-107081579 GGGATTTCATTGGGATTGTGTGG + Intronic
1196793081 X:119481769-119481791 GGGTTCTCATGGGCTTTTAGTGG - Intergenic
1198931997 X:141871921-141871943 GGGTTCACACGGGCAATGAGCGG + Intronic
1199513445 X:148648936-148648958 GGGTTTTCATGCTGATTGATAGG + Intronic
1199531701 X:148855289-148855311 GGGCTTTCATGGGCATTGCTTGG - Intronic
1199613778 X:149639390-149639412 GAGTCTACATGGGCATTGATTGG - Intergenic
1200184672 X:154174641-154174663 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200190325 X:154211779-154211801 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200196076 X:154249581-154249603 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200201731 X:154286699-154286721 GGGTTTCCATGGGCCCTCAGGGG - Intronic
1200434911 Y:3139458-3139480 GGGTTTTTATGGGCTTTCAATGG + Intergenic
1201499660 Y:14627841-14627863 GGGTTTTCAGTCCCATTGAGAGG - Intronic