ID: 962872909

View in Genome Browser
Species Human (GRCh38)
Location 3:139513649-139513671
Sequence CTGTCTCAGTAGCAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962872909_962872916 5 Left 962872909 3:139513649-139513671 CCCTCTCCTTGCTACTGAGACAG No data
Right 962872916 3:139513677-139513699 GGGGGCTTCCCGCCCTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962872909 Original CRISPR CTGTCTCAGTAGCAAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr