ID: 962874280

View in Genome Browser
Species Human (GRCh38)
Location 3:139523916-139523938
Sequence CAGGCATCGTGGTGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962874280_962874283 -2 Left 962874280 3:139523916-139523938 CCTGCTGAGCACCACGATGCCTG 0: 1
1: 0
2: 2
3: 31
4: 197
Right 962874283 3:139523937-139523959 TGCTTCCTTTATATGTTAACTGG 0: 1
1: 0
2: 0
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962874280 Original CRISPR CAGGCATCGTGGTGCTCAGC AGG (reversed) Intronic
900174453 1:1285629-1285651 CAGGCAGCGTTGTGCTGAGTGGG - Exonic
900627209 1:3613924-3613946 CAGGCATTGTGTTGAGCAGCTGG + Intergenic
902007477 1:13243763-13243785 CGGGCATGGTGGTGCACACCTGG + Intergenic
902026448 1:13387594-13387616 CAGGCATGGTGGTGTGCACCTGG + Intergenic
902330866 1:15730704-15730726 CGTGCTTCGTGGTGCTCAGGTGG + Exonic
903047998 1:20578832-20578854 CTGGCTTCTTGGTGCTAAGCGGG - Intergenic
903541659 1:24099800-24099822 CAGGCAGGGTGGTTCTAAGCGGG + Intronic
905104999 1:35558837-35558859 CATGCATGCTGCTGCTCAGCCGG - Intronic
905809897 1:40904539-40904561 CAGGCATGGTGGTGCACACCTGG + Intergenic
907229893 1:52987050-52987072 CAGGCATGGTGGTGCACCCCTGG - Intronic
907288206 1:53395722-53395744 GAGGCTTCCTGGAGCTCAGCTGG - Intergenic
908268380 1:62399970-62399992 CAGTCATGGTGGTGCACATCTGG + Intergenic
908762054 1:67521722-67521744 CAGGCATGGTGGTGGGCACCTGG - Intergenic
908926121 1:69257164-69257186 CAGCCATCTTGGTGCTCACTGGG - Intergenic
915974533 1:160376273-160376295 CTTGCATCCTGGTGCACAGCTGG - Intergenic
920212593 1:204339168-204339190 CTGTCATCGGGGAGCTCAGCGGG - Intronic
922592668 1:226789830-226789852 CAGGCATGGTGGTACTCAGGAGG - Intergenic
923169515 1:231400906-231400928 CAGGCATGCTGGTGCACATCTGG + Intronic
924089346 1:240486483-240486505 CAGGCAGCATGGTGCTGGGCAGG + Intergenic
924594861 1:245436033-245436055 CAGGCGTGGTGGTGCGCACCTGG + Intronic
1063151007 10:3336332-3336354 GAGGCAGCGTGGAGCACAGCCGG + Intergenic
1064661214 10:17609840-17609862 CAGGCATGGTGGTGCACGCCTGG + Intronic
1065444467 10:25783659-25783681 CAGGCATGGTGGTGTTCACTGGG + Intergenic
1066188107 10:33030387-33030409 CAGGCATAGCAGTGCTCAGCAGG + Intergenic
1069395320 10:67981678-67981700 CAGGCATGGTGGTTCACACCGGG + Intronic
1069697833 10:70400260-70400282 CAGGCATCATGGTGCACGTCGGG - Intergenic
1069748548 10:70731523-70731545 CATGCATGGTAGTGCTTAGCTGG + Intronic
1071508882 10:86249129-86249151 CAGGCATCGTGGCTGTCAGAAGG - Intronic
1072523305 10:96249457-96249479 CAGCCATGCTGGTGCTCTGCTGG + Intronic
1072548375 10:96457757-96457779 CAGGGATCTGGGTGCACAGCGGG + Intronic
1073739641 10:106392309-106392331 CGGGCATGGTGGTGCACACCTGG + Intergenic
1073870121 10:107853699-107853721 GAGGCTTCCTGGTGCTCAGATGG - Intergenic
1074285466 10:112093716-112093738 GAGGCAGCGAGGTGTTCAGCAGG - Intergenic
1076138873 10:128064140-128064162 CAGGCCTTGGGGAGCTCAGCTGG + Intronic
1077348480 11:2076423-2076445 CAGGCATGGTGGTGCACACCTGG - Intergenic
1078475836 11:11629184-11629206 CAGGCATCAAGGTGGTCACCAGG - Intergenic
1080561028 11:33462966-33462988 CAGGCATGGTGGCGCACACCTGG - Intergenic
1080772438 11:35354316-35354338 CAGGCATGATGGTGCACACCTGG + Intronic
1082068786 11:47921965-47921987 CAGGCATGGTAGTGCACACCTGG - Intergenic
1084306295 11:68286261-68286283 CAGGCATGGTGGTACTGAGGTGG - Intergenic
1086344565 11:85883057-85883079 CAGGCATAGTGGTGTGCACCTGG - Intronic
1088132494 11:106510702-106510724 CAGGCATCCTGCTTCTCTGCAGG - Intergenic
1089896670 11:121936905-121936927 CATGCATAGTTGTGGTCAGCAGG + Intergenic
1091321525 11:134655635-134655657 AAGGCGACTTGGTGCTCAGCAGG - Intergenic
1091356949 11:134944492-134944514 CAGGCCTCTTGGTGCCAAGCAGG + Intergenic
1091480190 12:820614-820636 CAGGCATGGTGGTACACACCTGG - Intronic
1091559879 12:1604031-1604053 CTGGCATTGTGGTGCGCACCAGG + Intronic
1091983030 12:4881920-4881942 GAGGCAGTGTGGTGCTCCGCTGG + Intergenic
1093021850 12:14211269-14211291 CTGGCATGGTGGTGCACACCTGG + Intergenic
1094665495 12:32516281-32516303 CAGGCATGGTGGCGCACACCTGG - Intronic
1094833602 12:34312007-34312029 CAGGCACCGTGGTGCGAACCAGG + Intergenic
1096264387 12:50111675-50111697 CAGGCATCGCGGTGCCCCTCGGG + Intergenic
1096581797 12:52590468-52590490 CAGGCAGCTCGCTGCTCAGCAGG - Intronic
1096728123 12:53581979-53582001 CGGGTATGGTGGTGCTCAGGAGG + Intronic
1098341482 12:69456049-69456071 CAGGTATGGTGGTGCACACCTGG - Intergenic
1098598644 12:72303003-72303025 CAAGCATAGTGGTTCTCAACGGG - Intronic
1099119527 12:78670886-78670908 CAGGCATGGTGGTGTGCACCTGG - Intergenic
1100493006 12:95099206-95099228 CAGGCATTGTGCTGCGCATCGGG - Intronic
1101141676 12:101801910-101801932 CAGGCATGGTGGCGCACACCTGG + Intronic
1104584328 12:130035841-130035863 CAGCCATCTTGGTGGTGAGCTGG + Intergenic
1105408462 13:20150784-20150806 CAGGGCCCGTGGTGCTCAGCTGG + Intronic
1105824033 13:24106173-24106195 CAGGCATAGTGGTGTACACCTGG - Intronic
1110955045 13:81543922-81543944 CAGACATGGTGGTGCACACCTGG + Intergenic
1110994750 13:82093277-82093299 CAGGCATGGTGGTGGGCACCTGG + Intergenic
1116878010 14:50133337-50133359 CAGGCATGGTGGTGCACGCCTGG - Intronic
1118865481 14:69700007-69700029 CAGGCAACATGGTGCCCACCAGG - Intronic
1120962579 14:90139027-90139049 CAGGCACAGTGGGGCTCAGAAGG + Intronic
1121322703 14:93001811-93001833 CAGGCCTTGTGGCCCTCAGCTGG - Intronic
1121965186 14:98297029-98297051 CAGGCAGCGTGGTGCTGTGGTGG + Intergenic
1125539685 15:40462847-40462869 CAGGCATGGTGGTGTGCACCAGG + Intronic
1125767638 15:42146006-42146028 CAGGCACCTTGGAGCACAGCGGG - Intronic
1125920414 15:43522153-43522175 CAGGCATCGTGCTGCCCAATGGG + Exonic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1126467716 15:48976029-48976051 CTGGCAGCCTGGTGCTCCGCTGG - Intergenic
1126745743 15:51824769-51824791 CAGGCATGGTTGTGCACACCTGG + Intergenic
1128179913 15:65593120-65593142 CAGGCATGGTGGTGCACACCTGG + Intronic
1128551109 15:68598564-68598586 CAGGCATGCTGGTGCTCACCAGG - Intronic
1128727772 15:70000492-70000514 CAGGCATCAGGGCTCTCAGCAGG - Intergenic
1128975813 15:72152575-72152597 CAGGCATGGTGGTGAGCATCTGG + Intergenic
1129692792 15:77723324-77723346 TCTGCATCATGGTGCTCAGCAGG - Intronic
1130854221 15:87826672-87826694 CAGGCATCTTGGAGCCGAGCTGG - Intergenic
1135730620 16:24892083-24892105 CAGGCACGGTGGTGTGCAGCTGG + Intronic
1136020298 16:27435912-27435934 CAGGCATGGTGGTGCACACCTGG - Intronic
1137526361 16:49239866-49239888 CAGGCATGGTGGTGCACACCTGG + Intergenic
1137560276 16:49497808-49497830 CAGCCATGTTCGTGCTCAGCAGG + Intronic
1139781876 16:69358420-69358442 CAGGCATGGTGGTTCACACCTGG - Intronic
1140489286 16:75320665-75320687 CAGTCACCGTGAGGCTCAGCTGG + Intronic
1141632926 16:85298567-85298589 CAGGCATGGTGGCGCACACCTGG - Intergenic
1142138269 16:88461279-88461301 CAAGCATCCTGGTCCTCACCAGG - Intronic
1142375515 16:89704994-89705016 CAGGCATGGTGGTTCACACCTGG - Intergenic
1143620379 17:8076939-8076961 CAGGCATCATGGCCCTCACCTGG - Intronic
1144997267 17:19278788-19278810 CAGGCATGGTGGTGCACACCTGG - Intronic
1145920524 17:28605948-28605970 CAGGCATGGTGGTGGGCACCTGG - Intronic
1147017619 17:37505031-37505053 CAGGCATAGTGGTGTGCACCTGG - Intronic
1148138035 17:45308246-45308268 CAGGCACCGTGCTGGCCAGCAGG + Intronic
1148803341 17:50247880-50247902 CAGGCTTGGTGGTGGGCAGCTGG - Intergenic
1150496092 17:65608863-65608885 CAGGCATGGTGGTGCACACTTGG + Intronic
1150813927 17:68378087-68378109 CAGGCAGCGCCCTGCTCAGCAGG + Intronic
1152926846 17:83091239-83091261 CGGGCCTCGAGGCGCTCAGCAGG + Intronic
1154385696 18:13889931-13889953 CAGGCTTTGTGTTGCACAGCTGG + Intronic
1154497718 18:14974803-14974825 CAGGCCTCTTGGTGCCAAGCAGG - Intergenic
1156231560 18:35158204-35158226 CTGTCATCTAGGTGCTCAGCTGG - Intergenic
1157743294 18:50112519-50112541 TAGGGCTGGTGGTGCTCAGCTGG - Intronic
1160322928 18:77913643-77913665 CGGGCATGGTGGTGCACACCTGG - Intergenic
1160546641 18:79661316-79661338 CGGGCATGGTGGTGCACACCTGG + Intergenic
1160696042 19:484963-484985 CAGGCCCCGTGGTGCCCACCTGG - Intergenic
1161188747 19:2941031-2941053 CAGGCATGGTGGGGCACACCTGG + Intronic
1162877224 19:13629471-13629493 CAGGCATGGTGGTGCGCGCCTGG + Intergenic
1163321767 19:16578676-16578698 CAGGCATCCTGGGTTTCAGCAGG - Intronic
1163361211 19:16847421-16847443 CAGGCAGGGTGGGGCTCTGCAGG - Intronic
1163403071 19:17106135-17106157 CGGGCATGGTGGTGCACACCTGG - Intronic
1163972832 19:20816248-20816270 CAGGCATCTTGGTGCACACCTGG + Intronic
1165553755 19:36611146-36611168 CAGGCATGGTGGTGGACACCTGG + Intronic
1166800389 19:45453168-45453190 CGGGCATGGTGGTGCACACCTGG + Intronic
925423130 2:3727621-3727643 CAGGCACCGAGGTGCTCAGTGGG + Intronic
926599598 2:14827867-14827889 CAGGCACAGTGTTGCACAGCAGG - Intergenic
928176285 2:29036456-29036478 CAGGCAGCTTGGAGCTCACCTGG - Intronic
931422444 2:62140915-62140937 CAGGCGTGGTGGTGCTGAGGTGG - Intronic
933447131 2:82395744-82395766 CAGGCAACATGGTGCTGACCGGG - Intergenic
934873232 2:97887319-97887341 CAGGCACAGAGATGCTCAGCTGG + Intronic
935566262 2:104610852-104610874 CAGGCATGGTGGTGCCCACCTGG + Intergenic
937926602 2:127172457-127172479 CAGGCATGGTGGCGCACACCTGG + Intergenic
938032745 2:128009327-128009349 TAGGCATGGTGGTGCACATCTGG + Intronic
938408215 2:131044451-131044473 CGGGCTTCCTGGTGCACAGCAGG - Exonic
943671184 2:190662871-190662893 CAGGAATTGGGGTGCTGAGCAGG + Intronic
943781828 2:191832404-191832426 CTGGCATTGGAGTGCTCAGCTGG + Intergenic
946819970 2:223619475-223619497 CAGGAAAAGTGGTGCTCTGCTGG - Intergenic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1171228116 20:23458280-23458302 CAGGCATGGAGTTGCTCTGCTGG + Intergenic
1173448669 20:43143029-43143051 CAGGCAGCATGGGGCTGAGCTGG + Intronic
1173866268 20:46314322-46314344 CAGCCCTCCTGGTGCTCAGCAGG - Intergenic
1173956250 20:47035227-47035249 CAAGGATCCTGCTGCTCAGCTGG + Intronic
1174138541 20:48397341-48397363 CAGGGGTTGTGGTGATCAGCAGG + Intergenic
1174575023 20:51531180-51531202 CAGGAGCCGTGGTTCTCAGCTGG - Intronic
1174868077 20:54157209-54157231 CAGGCACCCTGGTGCCCAGCCGG - Exonic
1175767331 20:61600483-61600505 GAGCCATAGTGGTGCTCAGGTGG + Intronic
1176384931 21:6134562-6134584 CAGGCAGGGTGGTTCTGAGCGGG - Intergenic
1179738541 21:43403690-43403712 CAGGCAGGGTGGTTCTGAGCGGG + Intergenic
1180608318 22:17078516-17078538 CAGGCATGGTGGTGCACACCTGG + Intergenic
1180796441 22:18608114-18608136 CAGGTGTCCTGGTGGTCAGCTGG - Exonic
1180906513 22:19416479-19416501 CAGGCGTGGTGGTGCGCACCAGG - Intronic
1181225283 22:21387157-21387179 CAGGTGTCCTGGTGGTCAGCTGG + Exonic
1181253350 22:21547656-21547678 CAGGTGTCCTGGTGGTCAGCTGG - Exonic
1182449059 22:30407537-30407559 CCCGCATCTTGGTCCTCAGCAGG - Exonic
1183701607 22:39454298-39454320 TAGGCACGGAGGTGCTCAGCAGG - Intergenic
1184071330 22:42149349-42149371 CAGGCATAGTGATTCTCAGCAGG - Intergenic
1184432789 22:44451271-44451293 CAGGCATCTGGGGGCTCAGAAGG - Intergenic
1185369582 22:50454852-50454874 CAGGCGTCCTCTTGCTCAGCCGG + Exonic
1185417911 22:50720224-50720246 CTTGCATCGAGGTGCTCCGCGGG - Intergenic
950290654 3:11781591-11781613 CAAGCATGGTGGTGCACATCTGG + Intergenic
951568380 3:24036359-24036381 CAGGCATGGTGGTGCACAACTGG - Intergenic
951881586 3:27485001-27485023 CAGCTGTCGTGGTGCTCAGTGGG - Intergenic
956691336 3:71880498-71880520 CAGGCATGGTGGTGGGCACCTGG + Intergenic
961663417 3:128482283-128482305 CAGGCATCCTGAGGCTGAGCCGG + Intronic
961670624 3:128526290-128526312 CAGGCATGGTGGTGTGCACCTGG + Intergenic
962468742 3:135686479-135686501 CAGGCCTCATGGTGGGCAGCAGG + Intergenic
962874280 3:139523916-139523938 CAGGCATCGTGGTGCTCAGCAGG - Intronic
963790620 3:149578753-149578775 CAGGCATGGTGGTGCTACTCGGG + Intronic
964024181 3:152051906-152051928 CAGAGACCCTGGTGCTCAGCAGG + Intergenic
964539319 3:157761728-157761750 CTGGCATAGTGTGGCTCAGCTGG - Intergenic
964629850 3:158798563-158798585 CAGGCACCGTGGTTCACACCTGG - Intronic
968804179 4:2761951-2761973 CAGGCATGGGAGGGCTCAGCCGG + Intergenic
969712585 4:8852509-8852531 GAGGCAGCGTGGTGCAGAGCAGG - Intronic
969885343 4:10210263-10210285 CAGACACCGTGGTGCCCAGAGGG - Intergenic
970634937 4:17998821-17998843 CAGGCATGGTTGTGCACATCGGG + Intronic
980517609 4:133884465-133884487 CAGGTAAAATGGTGCTCAGCAGG - Intergenic
982642850 4:157984590-157984612 CAGGAATTGTGGTGCACACCTGG + Intergenic
984236000 4:177159743-177159765 CAGCCAGCGTGGAGCTCAGAGGG + Intergenic
985306720 4:188550535-188550557 CAGTGCTCGTGGTTCTCAGCAGG - Intergenic
985545545 5:507405-507427 CAGGCCTGGTGGTGCTCGCCTGG - Intronic
986309761 5:6543402-6543424 CAGTCCTGGTGGGGCTCAGCAGG + Intergenic
988712743 5:33794420-33794442 CAGGCAAGATGGTGCTGAGCCGG + Intronic
989029657 5:37105156-37105178 CAGGCATGGTGGTGCGCACCTGG + Intergenic
989036350 5:37176493-37176515 TAGGCATGGTGGTGCACACCTGG + Intronic
994158818 5:96532571-96532593 CAGGCATCGTGGCCCACACCTGG + Intronic
995022531 5:107382512-107382534 CAGGCATCGTGGTTCACACCTGG - Intronic
995663506 5:114513094-114513116 CAGGCATGGTGGTGCACACAAGG + Intergenic
998147180 5:139735975-139735997 CAGGCCTCGTGGGGCTGGGCTGG + Intergenic
998523812 5:142824574-142824596 CAGGCAGCATGGAGCTCGGCAGG + Intronic
1000431990 5:161163328-161163350 CAGGCGTGGTGGTGCACACCTGG - Intergenic
1001429942 5:171651604-171651626 CAGGCATAGTGGTGTGTAGCTGG - Intergenic
1002087360 5:176784628-176784650 CAGGCATCGTCCTGCTCAGTGGG - Intergenic
1002271706 5:178076690-178076712 CAGGCATGGTGGTGCACACCTGG + Intergenic
1003295946 6:4828397-4828419 CAGGCATGGTGGTGTGCACCTGG - Intronic
1006042300 6:31266603-31266625 CAGAAATCTTGTTGCTCAGCCGG - Intergenic
1006750993 6:36376869-36376891 CAGGCAGCATGGGGCACAGCCGG + Intronic
1007068482 6:39016953-39016975 CAGCCACCGTGGAGCTCATCTGG + Intronic
1010173074 6:72995224-72995246 CAGGCATGGTGGTGCACGCCTGG + Intronic
1011612624 6:89168258-89168280 CAGGCATGGTGGTGCACACCTGG - Intergenic
1015112699 6:129611036-129611058 CAGGCATTGTGGTGGTCACCTGG - Intronic
1018745993 6:166762602-166762624 CAGGGACCGTGGTGCACAGCAGG - Intronic
1019117409 6:169776408-169776430 CAGGCATCATGATCCTCACCTGG - Intronic
1019308818 7:349019-349041 CAGGCATCGAGGTCCTTATCAGG + Intergenic
1021926562 7:25539790-25539812 CAGGCATCGTGATGTTCTCCTGG - Intergenic
1022743746 7:33148756-33148778 CAGGCATGGTGGGGCACACCTGG - Intronic
1023779686 7:43644116-43644138 CAGGCATGCTGCTCCTCAGCCGG + Intronic
1025613367 7:63097212-63097234 CAGGCACAGTGGTGCACACCTGG - Intergenic
1025945750 7:66103201-66103223 CTGGCATGGTGGTGCACACCTGG + Intronic
1027004250 7:74678911-74678933 CAGGCATGGTGGCGCACACCTGG - Intronic
1027812734 7:82925855-82925877 TAGGCATGGTGGTGCACACCTGG - Intronic
1028943473 7:96551561-96551583 CAGGCATGGTGGTGTGCACCTGG + Intronic
1029170696 7:98627437-98627459 CTGGCCTCGTGCTGCTCAGTTGG - Intronic
1029261068 7:99303235-99303257 CAGGCAGCCTGGTCCTCAGCAGG - Intergenic
1029340515 7:99940153-99940175 CAGGCATGGTGGTGGGCACCTGG - Intergenic
1029581073 7:101436855-101436877 CAGGCATGGTTGTGCACACCTGG - Intronic
1032796635 7:135282633-135282655 AAGGAATCGTAGTTCTCAGCGGG + Intergenic
1033075759 7:138248855-138248877 CAGGCATGGTGGTACACAGCTGG + Intergenic
1033093630 7:138410322-138410344 CAGGCATGGTGGCGCACACCTGG + Intergenic
1034059207 7:148070573-148070595 CAGGCATGGTGGTGCACACCTGG + Intronic
1034265768 7:149779966-149779988 CAGGCCTCGTGGTACTCAGCAGG - Intergenic
1034471427 7:151256611-151256633 CTGGCATCGTGCTGCCCGGCAGG + Intronic
1034912527 7:155009112-155009134 CAGGCATGGTGGTGCACGCCTGG + Intergenic
1036465990 8:8997733-8997755 CAGGCTTGGTGGTGCACACCTGG - Intergenic
1039050885 8:33492149-33492171 CAGGCATGGTGGTGCACACCTGG - Intronic
1045189557 8:99869331-99869353 GAGGCATCCTGCTCCTCAGCAGG + Intronic
1048904005 8:139069420-139069442 CAGGGACCCTGGTGCTGAGCAGG + Intergenic
1049101088 8:140579582-140579604 CATGCAGTGTGGTGCTTAGCAGG - Intronic
1049643520 8:143726130-143726152 CTGGCAGCGTGCGGCTCAGCCGG + Exonic
1050196381 9:3088286-3088308 CAGGCATCGTGGTGCCAGCCAGG + Intergenic
1051645920 9:19268239-19268261 CAGGTATAGTGGTGCACACCTGG - Intronic
1054911645 9:70460537-70460559 CAGGCATGGTGGTGCTCATCTGG + Intergenic
1055570956 9:77616583-77616605 CAGGCATGCTGATGCTCAGCAGG + Intronic
1055875195 9:80933735-80933757 CAGGCATCTTGGTGCTCGTTTGG - Intergenic
1057646206 9:96877409-96877431 CCGGCTTCGGGGTGCTTAGCGGG + Intergenic
1057742529 9:97724394-97724416 CAGGCATGGTGGTGCGTACCTGG + Intergenic
1061077458 9:128350360-128350382 CCGCCATCGTGGTGCACAGCAGG + Exonic
1061226026 9:129281522-129281544 CAGACATCATGGTCCTCAGGAGG + Intergenic
1186028555 X:5341552-5341574 CTGGCATGGTGGTGCACACCTGG + Intergenic
1186340893 X:8645262-8645284 CAGGCATCCTGTTGTCCAGCAGG + Intronic
1187137826 X:16565358-16565380 CAGGCATGGTGGTACACACCTGG + Intergenic
1187468469 X:19547008-19547030 CAGGCATGGTGGTGTGCACCTGG + Intronic