ID: 962875141

View in Genome Browser
Species Human (GRCh38)
Location 3:139530334-139530356
Sequence TACTCTCCCATTTTACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 3, 2: 12, 3: 106, 4: 551}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962875141_962875147 28 Left 962875141 3:139530334-139530356 CCTGTCTGTAAAATGGGAGAGTA 0: 1
1: 3
2: 12
3: 106
4: 551
Right 962875147 3:139530385-139530407 TTAAATAAACATAAAATGACAGG 0: 1
1: 0
2: 9
3: 102
4: 1029
962875141_962875148 29 Left 962875141 3:139530334-139530356 CCTGTCTGTAAAATGGGAGAGTA 0: 1
1: 3
2: 12
3: 106
4: 551
Right 962875148 3:139530386-139530408 TAAATAAACATAAAATGACAGGG 0: 1
1: 0
2: 11
3: 178
4: 1390
962875141_962875142 -7 Left 962875141 3:139530334-139530356 CCTGTCTGTAAAATGGGAGAGTA 0: 1
1: 3
2: 12
3: 106
4: 551
Right 962875142 3:139530350-139530372 GAGAGTAGCACCTCCTATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 80
962875141_962875143 2 Left 962875141 3:139530334-139530356 CCTGTCTGTAAAATGGGAGAGTA 0: 1
1: 3
2: 12
3: 106
4: 551
Right 962875143 3:139530359-139530381 ACCTCCTATCCAGGATTGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962875141 Original CRISPR TACTCTCCCATTTTACAGAC AGG (reversed) Intronic
900382876 1:2393621-2393643 TGTTGTCCCATTTCACAGACTGG + Intronic
900689661 1:3972925-3972947 TTGTCACCCATTTTACAGATTGG + Intergenic
900867201 1:5277023-5277045 ATCACTCCCATTTCACAGACCGG + Intergenic
901664868 1:10820333-10820355 AACGTTCCCATTTTACAGATGGG + Intergenic
901771914 1:11534890-11534912 TATGACCCCATTTTACAGACTGG + Intronic
901872985 1:12149102-12149124 AAGCCTCCCATTTTACAGATGGG + Intergenic
902077002 1:13795323-13795345 TGTTCTCCCATTTTACAAATGGG + Intronic
902566024 1:17311905-17311927 AATTTTCCCATTTTACAGATGGG - Intronic
902744706 1:18465910-18465932 TCCCCACCCATTTTACAGATGGG + Intergenic
902824365 1:18962820-18962842 TACCTTCCCGTTTTACAGAGGGG - Intergenic
903739879 1:25552590-25552612 CTCTGTCCCATTTTACAGAGAGG - Intronic
904042270 1:27591788-27591810 TATTACCCCATTTTACAGATGGG - Intronic
904203667 1:28838451-28838473 TCCTCTCTCACTTTACAGATGGG - Intronic
904390308 1:30180859-30180881 TGAACTCCCATTTTACAGATGGG + Intergenic
905805450 1:40873798-40873820 GTTTCTCCCATTTTACAGAAAGG + Intergenic
905902516 1:41590964-41590986 TACTGTCCCTTTTTACAGATGGG - Intronic
906470250 1:46123730-46123752 TATTATCCCACTCTACAGACAGG - Intronic
906684727 1:47756038-47756060 TCCTCTCCCATTTTATTGATGGG + Intergenic
906775757 1:48528089-48528111 TATTGTCCCATTTTAGAGATGGG + Intergenic
906796101 1:48697449-48697471 ATCTTTCCCATTTTACAGATAGG + Intronic
906947523 1:50307830-50307852 TACTCCTTCATTTTATAGACAGG - Intergenic
907329681 1:53662899-53662921 TACACCCCCATTTTATAGATGGG + Intronic
907477689 1:54716437-54716459 CACACTCCCATTTTACAGAAGGG + Intronic
907486673 1:54782688-54782710 TACTCACTCATTGCACAGACAGG - Intronic
907799075 1:57746618-57746640 TACTCTGCCATTTTATATAAAGG - Intronic
907865436 1:58395396-58395418 TCTTCTCCCATTTTACAGATGGG - Intronic
908255614 1:62301221-62301243 AACTCTCTCATTTCACAGATGGG + Intronic
908326586 1:63029311-63029333 TACTACCCCATTTTACTGAGGGG + Intergenic
908395391 1:63720558-63720580 TATTGTCCCATTTTACATACAGG - Intergenic
908721027 1:67126126-67126148 TACCCCCACATTTTACAGATGGG - Intronic
908775852 1:67639305-67639327 TTATCTCCCATTTTACAGATGGG + Intergenic
908858869 1:68460555-68460577 AAATCTCCCATTTTACATATTGG + Intergenic
909277967 1:73712917-73712939 TAGTAACCCATTTTACATACAGG + Intergenic
910140265 1:84019366-84019388 AATTCTCTCATTTTACAGGCTGG + Intergenic
910568354 1:88671801-88671823 TACTATGCCATTTTACACAAGGG + Intergenic
910743931 1:90552501-90552523 CATACTCCCATTTTACAGATAGG - Intergenic
911301546 1:96180532-96180554 TACCCTCACATTTTGCTGACAGG - Intergenic
912368860 1:109157323-109157345 TATTTTACCATTTTACAGATGGG - Intronic
912643713 1:111371214-111371236 TACTCTCCCAGTTTGCTGACTGG + Intergenic
913438649 1:118873891-118873913 GACACTTCCATTTTAAAGACAGG + Intergenic
913561270 1:120022851-120022873 TTCTGTCCCATTTTATTGACAGG + Intronic
913636856 1:120770751-120770773 TTCTGTCCCATTTTATTGACAGG - Intergenic
914281857 1:146182261-146182283 TTCTGTCCCATTTTATTGACAGG + Intronic
914623735 1:149438044-149438066 TTCTGTCCCATTTTATTGACAGG - Intergenic
914997494 1:152557796-152557818 CCTTCTCCCATTTTACAGAGGGG - Intronic
916584547 1:166139115-166139137 CACACTCTCATTTTACAGACAGG + Intronic
917082293 1:171268532-171268554 TCCTCTCCCATTTCAGAGGCTGG + Intronic
919201143 1:194356845-194356867 TGCAGTCCCATTTTAAAGACAGG + Intergenic
919967945 1:202548047-202548069 TACTATCTCATTTTAATGACAGG + Intronic
920119982 1:203649208-203649230 CACTCTCCCATTCTACAGCGTGG - Intronic
920322078 1:205132069-205132091 TCCTCTCCCACCCTACAGACTGG + Intergenic
920379415 1:205527094-205527116 CACACTCCCATTTGACAGACTGG - Intronic
920613886 1:207470087-207470109 CACTCACCCTTTTCACAGACTGG - Exonic
920666474 1:207966212-207966234 AACCTTCCCATTTTACAGATGGG - Intergenic
920672673 1:208016369-208016391 TTCACTCCCATTTTAGAGATGGG - Intergenic
920748861 1:208655184-208655206 AACTCTTCTATTTTACAAACGGG + Intergenic
921499561 1:215884518-215884540 GTCATTCCCATTTTACAGACAGG - Intronic
922005922 1:221530676-221530698 TAATCTCCCATTCTACATCCAGG + Intergenic
922158207 1:223056748-223056770 TACTGTCCCATCTTAGAGATAGG + Intergenic
922168658 1:223136699-223136721 AACCATCCCATTTTACAGTCAGG - Intronic
922557874 1:226546862-226546884 TATTACCCCATTTTACAGATGGG - Intergenic
922983477 1:229848349-229848371 GATGCTCCCATTTTACAGATGGG - Intergenic
923541137 1:234889014-234889036 TATTCACCCATCTTACAGATGGG + Intergenic
923701713 1:236306079-236306101 TTATCCCCAATTTTACAGACGGG + Intergenic
924699640 1:246438577-246438599 TACTATGCCATTTTATAGAAGGG - Intronic
1063008321 10:1996216-1996238 TATTATCTCATTTTAGAGACAGG - Intergenic
1063549219 10:7013753-7013775 TATTATCCCGTTTTACAGAAGGG + Intergenic
1063549298 10:7014567-7014589 TACCATCCCAGTTTACAGATGGG + Intergenic
1063649607 10:7919619-7919641 TACTATACCATTTTACATAAGGG - Intronic
1063687468 10:8251207-8251229 TACTCTCTGATTGTAAAGACTGG + Intergenic
1063949396 10:11208168-11208190 CACCCTCCCATTTTACAGATGGG - Intronic
1065498206 10:26351472-26351494 TACTATGCCATTTTACATAAGGG - Intergenic
1065646553 10:27840920-27840942 TACTCTCCCATTTTAAAGACTGG - Intronic
1066345136 10:34577653-34577675 TTCATCCCCATTTTACAGACAGG - Intronic
1066567123 10:36732892-36732914 TACTCTTCCACTTTAAAGGCGGG + Intergenic
1067393891 10:45893509-45893531 TACTATCTCCTTTTATAGACGGG + Intergenic
1067862214 10:49862642-49862664 TACTATCTCCTTTTATAGACGGG + Intronic
1067909746 10:50333950-50333972 CATTATCCCATTTTACAGAAGGG + Intronic
1068224111 10:54084271-54084293 CACTTTCCCATTTGACAGAAGGG - Intronic
1068417709 10:56745660-56745682 CACTCTCCCAGTTCACAGGCGGG - Intergenic
1068686135 10:59871716-59871738 TTATCTCCCATTTTACAGATGGG - Intronic
1069365984 10:67693060-67693082 TAATCTTCCATTTTGCACACAGG + Intronic
1069707022 10:70465324-70465346 TTCTCTTCCATTTTACAGGTGGG + Intergenic
1069724462 10:70568328-70568350 TATTCTCCCATTTTACAGATGGG - Exonic
1069801625 10:71085372-71085394 TCCTCCCCCATTTGACAGACAGG + Intergenic
1070049123 10:72869752-72869774 TACTATCCCATTTTATATAAGGG + Intronic
1070657550 10:78281768-78281790 AATTCTCCCATTTTACAGCTAGG - Intergenic
1070757797 10:79004204-79004226 GACACTCCCATTTGACAGATGGG - Intergenic
1071316719 10:84408314-84408336 TTCTCCCCCATTTTACAGAGTGG + Intronic
1071537844 10:86450955-86450977 TACTTTGCCACTTTCCAGACTGG + Intronic
1072095415 10:92173710-92173732 GACTTTCTCATTTTACAGACTGG - Intronic
1072454239 10:95561796-95561818 TATTATGCCATTTTACAGATGGG - Intergenic
1072515053 10:96173135-96173157 TACTATGCCATTTTACATAAGGG + Intronic
1072756023 10:98021541-98021563 TTATTTCCCATTTTACAGAACGG - Intronic
1072761552 10:98060938-98060960 GAGTTTCCCATTTTACAGATGGG + Intergenic
1072775457 10:98187465-98187487 TACTAGCCCTTTTTACAGATGGG - Intronic
1073602760 10:104863054-104863076 TACTCTTCCTTTTTGCAGAGCGG + Intronic
1073643952 10:105280297-105280319 TACTAGCCCATTTGACAGTCTGG - Intergenic
1074545550 10:114399586-114399608 TTCACTCCCATTTGAGAGACAGG - Intronic
1074770880 10:116732950-116732972 CACCCTCTCATTTTACAGATGGG - Intronic
1075133618 10:119762691-119762713 TACTATGCCATTTTACATAAGGG + Intronic
1075134223 10:119768534-119768556 TTCTCTCCCTTTTAAGAGACAGG - Intronic
1075199689 10:120392219-120392241 TATCATCCCATTTTACAGATGGG - Intergenic
1075731321 10:124638451-124638473 TATTTCCCCATTTTACAGATGGG - Intronic
1075744155 10:124714934-124714956 TGTTATCCCATTTTACAGAGGGG + Intronic
1076737652 10:132465966-132465988 CACGCTCCCATTTTACAGATGGG + Intergenic
1077288687 11:1778952-1778974 TACCATCCCATTTTACAGATTGG - Intergenic
1077288719 11:1779077-1779099 CACCATCCCATTTTACAGATTGG - Intergenic
1077879021 11:6333227-6333249 TACTATCCCATTTCACAGTGAGG + Intergenic
1078141315 11:8695180-8695202 TACTATGCCATTTTATAGAAGGG + Intronic
1078659506 11:13275994-13276016 TATTGCCCCATTTTACAGATGGG - Intergenic
1078867940 11:15315710-15315732 AACTCTCCCATTTCACAAAATGG - Intergenic
1079006386 11:16794250-16794272 AACTCTCCCATTTTGCAGTTGGG - Intronic
1079274125 11:19017904-19017926 TACTCTTCTATTTTACACAGGGG - Intergenic
1080308938 11:30867365-30867387 TACTTTTACATTTTACAGACGGG - Intronic
1080407433 11:31991988-31992010 TAATACTCCATTTTACAGACAGG + Intronic
1080463019 11:32472131-32472153 TGTTCACCCATTTTACAAACGGG - Intergenic
1080871486 11:36240755-36240777 TTCTCTCCCATTTTACAGACAGG - Intergenic
1081129266 11:39357010-39357032 CAATGACCCATTTTACAGACAGG - Intergenic
1082641540 11:55667135-55667157 TACTCTGCCATTTTATATATGGG + Intergenic
1082772804 11:57221693-57221715 AACCTTCTCATTTTACAGACAGG - Intergenic
1083454874 11:62771862-62771884 AATGCTCCCATTTTACAGATAGG + Intronic
1083564637 11:63703241-63703263 TACTATGCCATTTTATACACAGG + Intronic
1084010488 11:66345809-66345831 TCACCTCCCTTTTTACAGACAGG + Exonic
1084266407 11:68007655-68007677 TTATGTCCCATTTTACAGATGGG + Intergenic
1084773315 11:71358063-71358085 TACTCTCCCATAATGCAGATGGG - Intergenic
1084937981 11:72597298-72597320 TATTGTCCCATTTTATAGTCAGG + Intronic
1085143100 11:74167061-74167083 TATGATCCCATTTTACAGATGGG + Intronic
1085269627 11:75262675-75262697 TACAATCCCATTTTACAGTTAGG + Intergenic
1085276715 11:75304882-75304904 TCCTCTCTCTTTTTAAAGACAGG - Intronic
1085463463 11:76708947-76708969 CACCATTCCATTTTACAGACAGG + Intergenic
1085506648 11:77064679-77064701 TAGAAGCCCATTTTACAGACAGG + Intergenic
1085744915 11:79106664-79106686 AACTCTCCCACTTTACAGATGGG + Intronic
1086946773 11:92851584-92851606 TACTCTGCCATTTTTGTGACAGG + Intronic
1087128640 11:94650564-94650586 TTCTTTCCCCTTTTACATACAGG + Intergenic
1087177000 11:95105280-95105302 TACTATGCCATTTTACATAAGGG - Intronic
1087562901 11:99814395-99814417 TACTCTCCCATAATACAGGATGG - Intronic
1088646571 11:111921497-111921519 TTTGTTCCCATTTTACAGACGGG - Intronic
1089342642 11:117769733-117769755 TATTCCCCCATTTTACAGATGGG - Intronic
1089993638 11:122884122-122884144 TATTCTCTAATATTACAGACTGG - Intronic
1091474605 12:759812-759834 TTTACACCCATTTTACAGACAGG - Intronic
1091741427 12:2962767-2962789 AAGTCTCCCATTTTAAAGATGGG + Intronic
1092527235 12:9316723-9316745 TTCTCTCCCATTCTACTGATTGG - Intergenic
1092540038 12:9415050-9415072 TTCTCTCCCATTCTACTGATTGG + Intergenic
1093853974 12:24076064-24076086 CACTCTCTCATTCTACAGGCTGG - Intergenic
1093970864 12:25374777-25374799 TGCACTCCCATTTTGCAGATTGG + Intergenic
1093983962 12:25507491-25507513 TTCTCTCTCATTTAACAGTCTGG + Intronic
1095472051 12:42547561-42547583 TTTTTTCCCATTTTACAGATAGG - Intronic
1095695951 12:45144238-45144260 TACTCTGCCATTTTGGAGGCTGG + Intergenic
1098867113 12:75775628-75775650 TATTATCTCATTTTACAGATAGG + Intergenic
1099272613 12:80530120-80530142 TACTCTCAAACTTTACAAACTGG + Intronic
1100204308 12:92331455-92331477 TACTATTCCACTTTACAGATGGG + Intergenic
1100443977 12:94643937-94643959 CACTTTTCCATTTTACAGATGGG - Intronic
1100884199 12:99051307-99051329 TAATCTCCCATTGTAAAGAATGG - Intronic
1101456927 12:104842614-104842636 ACCTCTCCCATTTTACAGAGGGG + Intronic
1101800181 12:108015096-108015118 TATTAGCCCATTTTACAGGCAGG - Intergenic
1101814609 12:108136336-108136358 TTCTCTCCCATTCTATAGATGGG - Intronic
1101841385 12:108329851-108329873 TACACTCCCATTTTTCAGATGGG - Intronic
1101977528 12:109374348-109374370 TTAGCTCCCATTTTACAGACGGG - Intronic
1102009968 12:109612168-109612190 TACCACCCCATTTGACAGACAGG - Intergenic
1102012309 12:109626311-109626333 TATCTTCCCCTTTTACAGACGGG + Intergenic
1102224681 12:111219594-111219616 TATACTCCCATTTAACAGATAGG - Intronic
1102254551 12:111407921-111407943 TACTCCCCCATTTTACACAGAGG - Intronic
1102289378 12:111686333-111686355 TTCTGTCCCACTTTACAGATAGG + Intronic
1102347276 12:112168156-112168178 CACTCTCCCATTTGACAGACAGG - Intronic
1102423519 12:112822758-112822780 TCTTGTCCCATTTTACAGATGGG - Intronic
1102427439 12:112855233-112855255 TTCACTCCCATTTTACAGATGGG - Intronic
1102488473 12:113274041-113274063 TACTCTGCCATTTTATATAAGGG - Intronic
1102703748 12:114863314-114863336 AACTGGCCCGTTTTACAGACGGG + Intergenic
1102797904 12:115704974-115704996 TATGACCCCATTTTACAGACAGG + Intergenic
1102880912 12:116484158-116484180 TTCATTCCCATTTTACAGATGGG + Intergenic
1102986172 12:117280476-117280498 TGTTCTCCCATTTCACAGATGGG - Intronic
1103168379 12:118790785-118790807 TTATCCCCCATTTTACAGATGGG - Intergenic
1103256162 12:119543177-119543199 TACTCTTTCATTTTTGAGACAGG - Intergenic
1103341222 12:120222212-120222234 TCTTGTCCCATTTTACAGATGGG + Intronic
1103731285 12:123029243-123029265 TAGTTTCCCATTTTACATATGGG - Intronic
1103778307 12:123382864-123382886 CACCCACCCATTTTACAGATGGG - Intergenic
1103780701 12:123396916-123396938 TATTGTACCATTTTACAGACTGG - Intronic
1103806844 12:123580424-123580446 TACTTCCCCATCTTCCAGACTGG - Intergenic
1103858800 12:123995068-123995090 TACAAGCCCATTTTACAGACAGG + Intronic
1104365729 12:128174916-128174938 TACTCATCCATTTCACAGATGGG + Intergenic
1104381941 12:128314940-128314962 CTCCCTCCCATTTTACAGGCTGG - Intronic
1104443502 12:128814582-128814604 TATTATCCCATCTTAAAGACAGG - Intronic
1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG + Intronic
1104613777 12:130252045-130252067 TACTCTTCCATTTTAGTGATTGG + Intergenic
1104919012 12:132280915-132280937 TATTGTCCCATTTTACATATGGG - Intronic
1105549043 13:21375243-21375265 TGCAGTCCCATTTTACAGACAGG + Exonic
1106065326 13:26342504-26342526 CACTGTCCCATTTTACAAATGGG - Intronic
1106481071 13:30137135-30137157 TATGCTCCCATTATACAGATGGG - Intergenic
1107332282 13:39314009-39314031 TACTACCCCATTTCACAGACAGG + Intergenic
1107884733 13:44865903-44865925 AGCTCTCCCATCTTGCAGACTGG - Intergenic
1107910862 13:45104755-45104777 CTCTTTCCCATTTTACAGATGGG + Intergenic
1108911363 13:55555891-55555913 TACTGTCCCATTGTGGAGACAGG - Intergenic
1110490481 13:76098527-76098549 TACTATACCATTTTACATTCTGG + Intergenic
1111388923 13:87565245-87565267 TACTATCCCATTGTACAGATAGG + Intergenic
1112378859 13:98869586-98869608 TTCATCCCCATTTTACAGACAGG + Intronic
1113062849 13:106342733-106342755 TACACTCCCATTTTACAGTCAGG - Intergenic
1113427720 13:110223082-110223104 TACTCTCCCAATTTATAAAATGG - Intronic
1113702467 13:112397468-112397490 CACACCCCCATTTTACAGACAGG + Intronic
1115521995 14:34242151-34242173 ATCACTCCCATTTTACAGATGGG - Intronic
1118234055 14:63984530-63984552 TTTTCCCCCATTTTACAGAAAGG - Intronic
1118759691 14:68872621-68872643 TTTTCCCCCATTTTACAGACAGG + Intergenic
1119428464 14:74550927-74550949 GACTCTCCCATTTCCCAGATGGG - Intronic
1119432396 14:74576963-74576985 AACCCTCTCATTTTACAGAAAGG + Intronic
1119636031 14:76274178-76274200 AACATTCCCATTTTACAGATGGG + Intergenic
1119643737 14:76333979-76334001 TCCTGCCCCATTTTACAGATGGG - Intronic
1120834168 14:89026099-89026121 TGCGTTCCTATTTTACAGACAGG + Intergenic
1120927763 14:89814729-89814751 CACTCTTTCATTTTACAGATGGG + Intronic
1121019013 14:90567618-90567640 TAGTCTCCCATTTTACAGATAGG + Intronic
1121182730 14:91941767-91941789 TACCCCCCCATTTTACAGATGGG - Intronic
1121317367 14:92970299-92970321 AACACTCCCATTTTATAGAGAGG - Intronic
1121660381 14:95630979-95631001 TACTCTTCCATTTTCCTCACTGG - Intergenic
1121745951 14:96292861-96292883 TACTATCCCATTTTATATAAGGG - Intronic
1121775848 14:96590358-96590380 TATGCTCCCATTTTACAGATGGG + Intergenic
1122094802 14:99363046-99363068 CTTCCTCCCATTTTACAGACTGG - Intergenic
1122292997 14:100689435-100689457 TATTTTCCCCTTTTACAGACAGG + Intergenic
1125794310 15:42393136-42393158 TACTACTCCATTTTACAGAAGGG - Intronic
1126054637 15:44718559-44718581 TACTATACCATTTTATAGAAGGG - Exonic
1126059319 15:44764330-44764352 TACTCTCCCTCTATACAGAGTGG + Intronic
1126357591 15:47812715-47812737 AACTCTCCCATTCTGCAGAGGGG - Intergenic
1126668675 15:51096046-51096068 TTCATTCCCATTTTACAGATGGG + Intronic
1126959601 15:53976992-53977014 TACTCTCCAGTGTTACAGCCGGG + Intergenic
1127864019 15:63017085-63017107 TACTGTCCCATTGTTCACACAGG + Intergenic
1127912256 15:63427001-63427023 TAATGGACCATTTTACAGACTGG - Intergenic
1128525836 15:68411723-68411745 TACTCTCCTCTTTTAGAGGCAGG - Intronic
1128561016 15:68667699-68667721 CACTCTCCCATCTCACAGATGGG - Intronic
1128665272 15:69533027-69533049 GCCTCTCCCATTGTACAGACTGG + Intergenic
1128853992 15:70991410-70991432 TACTATCCCATTTTATATAAGGG - Intronic
1128885950 15:71288424-71288446 AACTCTCTCATTGTACAGATGGG + Intronic
1128959449 15:71986256-71986278 TACTATGCCATTTTACATAAGGG + Intronic
1129364863 15:75048032-75048054 TGCTGTCCCATTTCACAGATAGG - Intronic
1129444068 15:75603937-75603959 TGTTATCCCATTTTACAGATGGG - Intronic
1129599153 15:76988115-76988137 TACTTTCTCATTTTACAAATGGG - Intergenic
1129877004 15:78982123-78982145 TACCCTCCCATTTTCCAGATGGG - Intronic
1129881614 15:79010380-79010402 CACTCTCCCATTTTGCAGACAGG - Intronic
1130201594 15:81834062-81834084 CACTGTCCCCTTTTCCAGACTGG + Intergenic
1130203918 15:81858350-81858372 CACTCTCCCATTAGACAGCCTGG - Intergenic
1130346824 15:83054983-83055005 AACCCTCTCATTTTACAAACGGG - Intronic
1130373753 15:83309775-83309797 TACTCTCCCATTTTATAGATGGG - Intergenic
1130853807 15:87823168-87823190 GACACTCTCATTTTACAGATTGG - Intergenic
1132955590 16:2591565-2591587 TACTCAGCCTTTTTAGAGACTGG - Intronic
1133416232 16:5609257-5609279 TGCTATCTCATTTTACAGAAAGG + Intergenic
1133448362 16:5882250-5882272 TTCACTCCCATTTTACAGATTGG + Intergenic
1133698793 16:8289863-8289885 TACACTTCCATTTTACAGATGGG + Intergenic
1133772721 16:8877025-8877047 TATTGTCCCATTCTACAGATGGG + Intergenic
1134021015 16:10921788-10921810 TACTGCCCCATTTTAAAGACAGG - Intronic
1134068495 16:11245868-11245890 TATTGTCTAATTTTACAGACAGG - Intergenic
1134749450 16:16614270-16614292 TTCTCTCCTTTTTTAAAGACAGG + Intergenic
1134756742 16:16673902-16673924 CATTATCCCATTTTACAGATGGG - Intergenic
1134810434 16:17162434-17162456 TTCACTCTCATTTTACGGACGGG + Intronic
1134829622 16:17312711-17312733 TATTATCCCATTTTGCAGATGGG + Intronic
1134989326 16:18685261-18685283 CATTATCCCATTTTACAGATGGG + Intergenic
1134996020 16:18739354-18739376 TTCTCTCCTTTTTTAAAGACAGG - Intergenic
1135062801 16:19285472-19285494 TACCATCCCATTTTACAGAGGGG + Intergenic
1135169101 16:20167220-20167242 TCCTACCCCATTTTACAGATGGG - Intergenic
1135347636 16:21702571-21702593 TTATCTCCCATTTTACAGATGGG - Intronic
1135349792 16:21719028-21719050 CACAATCCCATTTTACAGATGGG - Intronic
1135829974 16:25764356-25764378 TACAATACCATTTTACAGATGGG + Intronic
1136021899 16:27445834-27445856 ACTTCTCCCATTTTACAGAAGGG + Intronic
1137289162 16:47039950-47039972 TTTTCCTCCATTTTACAGACAGG + Intergenic
1137661834 16:50213891-50213913 TACTCTACCATTTTATAGCAGGG + Intronic
1137703828 16:50519791-50519813 GACTGTGCCATTTTACAGATGGG - Intergenic
1137786116 16:51139237-51139259 TCCTCTTCCCTTTTAGAGACCGG - Exonic
1138484933 16:57334328-57334350 CCCTCTACCATTTTATAGACTGG + Intergenic
1138546000 16:57720159-57720181 TATTATCCCATTTTACCGATGGG + Intronic
1139239782 16:65378973-65378995 TACATTCCCATTTTATAGAGAGG + Intergenic
1139936692 16:70576811-70576833 TATTCTACCAATTTACAGGCAGG - Exonic
1139944394 16:70629492-70629514 TACTATGCCATTTTACATAAGGG - Intronic
1139971727 16:70780610-70780632 TTCTCCCCCATTCTGCAGACAGG - Intronic
1140701313 16:77584057-77584079 GACTGTCCCATGTTACAGAAAGG - Intergenic
1140877802 16:79169191-79169213 AAGTCTCCCATTTCAGAGACAGG + Intronic
1140946420 16:79772221-79772243 TACACTCCCATTTAATAGACTGG - Intergenic
1141444403 16:84048858-84048880 TTGTCTCCCATTTTATATACAGG - Intergenic
1141613701 16:85198266-85198288 TCCTCTCCCCTTTTACAGCCAGG - Intergenic
1141624909 16:85256053-85256075 TATTCTCCCATCTTACATATGGG - Intergenic
1141793443 16:86252298-86252320 CAATCCCCTATTTTACAGACGGG + Intergenic
1141991566 16:87613862-87613884 TCCGCTCCCATTTAAAAGACAGG + Intronic
1142638899 17:1273705-1273727 TTCTAGCCCATTATACAGACGGG - Intergenic
1142865943 17:2791605-2791627 TGTTATCCCATTTTACAGATAGG - Intronic
1142954816 17:3514483-3514505 AACCCTCCCATTTGACAGATGGG + Intronic
1143029142 17:3957798-3957820 CACTCTCTCATTTAACAGATAGG - Intronic
1143693773 17:8594716-8594738 TACTCTGCCATTTTATATAAGGG - Intronic
1144744509 17:17604769-17604791 TACTGTACCATTATACAGATGGG - Intergenic
1144822932 17:18088135-18088157 TGTTCCCCCATTTTACAGACAGG - Intronic
1144950448 17:18990880-18990902 CCCTTTCCCATTTTATAGACAGG + Intronic
1145857556 17:28176497-28176519 TACTATTCCTTTTTACAGATGGG + Intronic
1145898141 17:28472630-28472652 TACTATTCCATTTAACAGATGGG - Intronic
1146889464 17:36496807-36496829 TATTAGCCCATTTTATAGACAGG + Intronic
1147027489 17:37600675-37600697 AACTCTCTCATTTTATAGATGGG - Intronic
1147124291 17:38355238-38355260 CGCTCACCCATTTTACAGATGGG - Intronic
1148159770 17:45443347-45443369 CACTGGCCCATTTTATAGACGGG + Intronic
1148205500 17:45777228-45777250 TATTTTTCCATTTTACAGATAGG - Intergenic
1148222076 17:45870054-45870076 AATCCTCTCATTTTACAGACAGG - Intergenic
1148326851 17:46788320-46788342 CAGTCTCCCATTTTACAGATTGG + Intronic
1148798415 17:50208612-50208634 TACTACCCCAGTTCACAGACTGG - Intergenic
1149621184 17:58046541-58046563 TACTGTCCCATTTTATAGATGGG + Intergenic
1150320652 17:64211652-64211674 TACTATGCCATTTTACATAAGGG + Intronic
1150391058 17:64790219-64790241 CACTGGCCCATTTTATAGACGGG + Intergenic
1150409839 17:64934271-64934293 CACTGGCCCATTTTACAGACGGG + Intergenic
1150487743 17:65555658-65555680 TGCCCACCCATTTTACAGATGGG + Intronic
1151205525 17:72503725-72503747 TACTATCCCATTGCACAGATGGG + Intergenic
1151624183 17:75266429-75266451 TGCTTACCCATTTTACAGATGGG + Exonic
1151903913 17:77035493-77035515 TAACCTCTCATTTTACAAACAGG + Intergenic
1151911057 17:77083612-77083634 TAGTTTTCCATTTTACAGATGGG - Intergenic
1151966034 17:77432203-77432225 TATTAGCCCATTTTACAGAGGGG - Intronic
1151975662 17:77482424-77482446 TGCTGCCCCATTTTACAGAAGGG - Intronic
1153247965 18:3092200-3092222 TACTCTCTCTTTTTAGAGATAGG + Intronic
1154412779 18:14150340-14150362 TCTCATCCCATTTTACAGACAGG + Intergenic
1155176001 18:23301710-23301732 TCCTCTCCCGTTTTATAGATGGG - Intronic
1155434530 18:25797845-25797867 TATTACCCCATTTTACAGATGGG + Intergenic
1156169009 18:34459235-34459257 TATTTCTCCATTTTACAGACAGG - Intergenic
1156577797 18:38338656-38338678 TATTCTTCCTTTTTAGAGACAGG - Intergenic
1157132362 18:45018680-45018702 TTTATTCCCATTTTACAGACAGG + Intronic
1160125925 18:76171350-76171372 TTTAGTCCCATTTTACAGACAGG - Intergenic
1160674575 19:382949-382971 GAATCTGCCATTTTAGAGACTGG - Intergenic
1160750420 19:731446-731468 TACTCCCCCATCTTACAGATGGG - Intronic
1160788149 19:911578-911600 TACTATCCCATTTTACAGAAGGG + Intronic
1160925475 19:1542914-1542936 TTCTCTCCCACTATACAGATGGG + Intergenic
1160942415 19:1626666-1626688 TACGTGCCCATTTTACAGACAGG - Intronic
1161261802 19:3341873-3341895 GCCTGTCCCATTTTACAGATGGG - Intergenic
1161430752 19:4230969-4230991 TACTAGCCCATTTTCCAGATAGG - Intronic
1161488243 19:4547551-4547573 TTTCCTCCCATTTTAGAGACGGG + Intronic
1161499614 19:4606804-4606826 TAGGATCCCATTTTATAGACGGG + Intergenic
1161629400 19:5344805-5344827 TATTATCCCCATTTACAGACAGG - Intergenic
1161679384 19:5672033-5672055 TACAACCCCATTTTGCAGACAGG + Intergenic
1161814897 19:6494104-6494126 TACGATCCCATTTTACAGGTGGG + Intergenic
1162068618 19:8140645-8140667 TTATCTACCATTTTACAGATGGG + Intronic
1162079789 19:8210957-8210979 TACTGACCCATTTTACAGATGGG - Intronic
1162370009 19:10272924-10272946 TACTCACCCACCTTACAGATGGG + Intronic
1163452959 19:17390120-17390142 CAATCACCCATTTTACAGATAGG + Intergenic
1163551743 19:17969358-17969380 CCCGTTCCCATTTTACAGACGGG - Intronic
1163557877 19:18002537-18002559 TCCCGGCCCATTTTACAGACGGG - Intronic
1163665195 19:18599956-18599978 TTGTCCCCCATTTTACAGATAGG + Intronic
1163675317 19:18652893-18652915 TATCATCCCATTTTACAGATGGG + Intronic
1163675981 19:18655519-18655541 TACCATCCCATCTTACAGATGGG - Intronic
1163838780 19:19592977-19592999 TTTTCTCCCGTTTTACAGATGGG - Intronic
1163970947 19:20794260-20794282 TACTCTCACAAATTTCAGACCGG - Intronic
1164001043 19:21099523-21099545 TACTCTCACATATTTCAGACAGG - Intronic
1164007874 19:21168049-21168071 TACTCTCACATATTTCAGACAGG - Intronic
1164756080 19:30690736-30690758 GATCCTTCCATTTTACAGACGGG - Intronic
1165317306 19:35064692-35064714 TATTATCCCATTTTAGAGAGGGG - Intronic
1165707397 19:37986259-37986281 TACTGTCCCATTCTACAGATGGG - Intronic
1165888676 19:39097893-39097915 TATTTTTCCATTTTACAGACAGG + Intronic
1166314486 19:41981395-41981417 ATCATTCCCATTTTACAGACGGG + Intronic
1166337352 19:42116531-42116553 TGCTGTCCCATCTTACAGAGGGG - Intronic
1166337602 19:42117674-42117696 CTCTTTTCCATTTTACAGACAGG - Intronic
1166714191 19:44955906-44955928 GACAGACCCATTTTACAGACGGG + Intronic
1167034109 19:46983303-46983325 TATTATCCCATTCTACAGACAGG - Intronic
1167689539 19:50976325-50976347 CTCTCTCCCATTTTACAGACAGG + Intergenic
1167834868 19:52060293-52060315 TCCTTTCCCCTTTTACATACAGG + Intronic
1167850948 19:52201472-52201494 TGGAGTCCCATTTTACAGACAGG - Intronic
1168079106 19:53996233-53996255 TACTCTCTTATTCTACAGATGGG - Intronic
1168472549 19:56651201-56651223 TGTTATCCCATTTTACAGATGGG + Intronic
925383505 2:3445621-3445643 TATTATCCCAATTTACAGATGGG + Intronic
926499672 2:13638220-13638242 TACTCTCCAAGTTTTCAGAATGG - Intergenic
926695000 2:15764913-15764935 AACACTCTCATTTTATAGACGGG - Intergenic
926723389 2:15979348-15979370 TTCTTTCCCTTTTTACAGCCTGG + Intergenic
926784535 2:16507368-16507390 TAATCTCCATTTTTACAGATGGG + Intergenic
927474655 2:23403335-23403357 TCCTTTCCCATTTTAAAAACTGG - Intronic
927692776 2:25219874-25219896 TATTGTCTCATTTTACAGATGGG - Intergenic
927815253 2:26210226-26210248 AACCCTCTCATTTTACAGATTGG + Intronic
927899920 2:26811915-26811937 GACTGACCCATTTTACAGACAGG + Intergenic
928292926 2:30055742-30055764 TATATCCCCATTTTACAGACGGG - Intergenic
929619718 2:43342208-43342230 TATTCTCCCTTTTTTTAGACAGG - Intronic
929626831 2:43417864-43417886 TACTATCCCATTCCACAGAGGGG - Intronic
931131064 2:59336604-59336626 CACTGTCCCATTTGACAAACAGG - Intergenic
931173559 2:59830390-59830412 TATTATCCCATTTTATAGATGGG + Intergenic
931666318 2:64611941-64611963 CATTATCCCATTTTACAGACGGG - Intergenic
932580370 2:72989380-72989402 TACTATCCCTTTTTACAGATAGG - Intronic
933840992 2:86285524-86285546 TACTACCCCATTTTACAGACTGG + Intronic
935326820 2:101945173-101945195 TTCTCCCCTATTTTACAGATAGG - Intergenic
935340854 2:102058587-102058609 TACTAACCCCATTTACAGACAGG - Intergenic
936634977 2:114245606-114245628 TACTCTTCCATTTCACATATAGG - Intergenic
937049624 2:118877777-118877799 TACTATGCCATTTTACATAAGGG + Intergenic
937067347 2:119027806-119027828 TTATCTCCCATTTTACAGATGGG + Intergenic
937151089 2:119686159-119686181 AATGCACCCATTTTACAGACAGG - Intronic
937249941 2:120517273-120517295 TATTATCCCATTTCACAGATGGG + Intergenic
937301354 2:120844559-120844581 AACCTTCCCATTTTACAGATGGG - Intronic
939966742 2:148617671-148617693 TACTATCACGTTTTACAGATAGG + Intergenic
945117346 2:206420989-206421011 TACTCTACCATTTTATATAAGGG - Intergenic
945798942 2:214400517-214400539 AACTCTGCCATTTTATAGAAGGG + Intronic
947578529 2:231295808-231295830 TTATCCCCCATTTTACAGAGAGG - Intronic
947645204 2:231733838-231733860 GTCTCTCCCATTTTACAAATGGG - Intronic
947765799 2:232636365-232636387 TGCTTTCCCATTTGACAGAAGGG - Intronic
948079891 2:235197285-235197307 TATCTTCCCATTTTACAGACTGG - Intergenic
948417751 2:237826876-237826898 TACTGTGCCATTTTACATAAGGG + Intronic
948892801 2:240915489-240915511 AACGCTCCCATTTCACAGATGGG + Intergenic
1168962062 20:1876734-1876756 CATTGTCCCATCTTACAGACAGG - Intergenic
1169608114 20:7346787-7346809 ATCTCTCCCATTCTACTGACTGG - Intergenic
1169637442 20:7707938-7707960 ATCACTCCCATTTTACACACTGG + Intergenic
1169857729 20:10122161-10122183 AATTTTCCCATTTTACAGATGGG - Intergenic
1170214278 20:13875417-13875439 TAAATTCCCATTTTACAGATGGG + Intronic
1170303468 20:14911837-14911859 TATTAACCCATTTTACAGATGGG + Intronic
1170933164 20:20787244-20787266 TAGTCTCCCATCTTTCAGAGGGG + Intergenic
1171069007 20:22048112-22048134 TATTATTCCATTTTACAGAAAGG + Intergenic
1171152643 20:22841417-22841439 TAATCTCCCAATTTATAGAGTGG - Intergenic
1171988392 20:31676701-31676723 AACACCCCCATTTCACAGACAGG + Intronic
1172000737 20:31774577-31774599 TACACTCCCATTTCACAGTGGGG + Intronic
1172009584 20:31838616-31838638 TCTTACCCCATTTTACAGACAGG - Intergenic
1172028264 20:31964337-31964359 CCCTCTCTCATTTTACAGGCAGG - Intergenic
1172035461 20:32007762-32007784 TAAGCTTCCATTTTATAGACAGG + Intergenic
1172186087 20:33031879-33031901 TATTCTCCCACTTTACAGAGGGG + Intronic
1172448278 20:35004291-35004313 CAGTGTCCCATTGTACAGACAGG - Intronic
1172488854 20:35317904-35317926 TACTGTCCCATCTTCCAGAAAGG + Intronic
1173104457 20:40120104-40120126 AATACTCCCATTTTACAGACGGG + Intergenic
1173579438 20:44136788-44136810 TAGTAACCCATTTTACAGATGGG - Intronic
1173763951 20:45589068-45589090 TAGTCCCCCATTTTACAGGATGG + Intergenic
1173835113 20:46119699-46119721 AACTCCCCCATTATACAGATGGG + Intronic
1173869200 20:46331123-46331145 ATCACTCCCATTTTACAGATGGG + Intergenic
1174043886 20:47719546-47719568 TTCTCTCCCATTTGACAGTTTGG - Intronic
1174563850 20:51450590-51450612 CACTATCTCATTTTACAGACAGG + Intronic
1174573625 20:51522086-51522108 TACTATACCATTTTACATAAGGG + Intronic
1174606348 20:51764708-51764730 AATTCTCCCATTTTATTGACAGG - Intronic
1174970087 20:55265136-55265158 TACTCTGGCATTTTACAGTGTGG + Intergenic
1175817528 20:61891287-61891309 TCGTGTCCCATTTTACAGAGGGG + Intronic
1176860227 21:14007915-14007937 TCTCATCCCATTTTACAGACAGG - Intergenic
1177335539 21:19720913-19720935 TCCTCTCCCTTTTTTCAGAAGGG + Intergenic
1177716329 21:24843750-24843772 CACTTTCCCATTTCACAGCCTGG + Intergenic
1178316113 21:31568110-31568132 TCTTCTTCCATTTTTCAGACAGG + Intergenic
1178486375 21:33022244-33022266 ATGACTCCCATTTTACAGACAGG - Intergenic
1178486801 21:33024651-33024673 CATTCACCCATTTTACAGATGGG - Intergenic
1180698734 22:17770307-17770329 GAGTGTCCCCTTTTACAGACGGG - Intronic
1181568326 22:23752764-23752786 TATTAACCCATTTTACAGAGGGG + Exonic
1181766384 22:25095174-25095196 ACCTCTGCCATTTTACAGAGGGG - Intronic
1181770959 22:25125223-25125245 TATTGTCCCATTTTACAGATGGG + Intronic
1181785624 22:25224682-25224704 TTATTTCCCATTTTACAGACGGG + Intronic
1181788728 22:25246466-25246488 AAGTCTCCCATTTTATAGATGGG + Intergenic
1181820413 22:25471167-25471189 AAGTCTCCCATTTTATAGATGGG + Intergenic
1182036183 22:27200274-27200296 TACGCTTCCATTTTACAGATAGG - Intergenic
1182096568 22:27630109-27630131 TACTGCTCCATTTTACAGATGGG - Intergenic
1182282322 22:29224750-29224772 TAGAATCCCATTTTACAGATGGG + Intronic
1182759952 22:32714333-32714355 CAAACTCCCATTTTACAGATAGG - Intronic
1182806961 22:33080841-33080863 TCTTTTCCCATTTTACAGATGGG - Intergenic
1182973829 22:34603666-34603688 AAGTCTTCCATTTTACAGATGGG + Intergenic
1183253507 22:36746131-36746153 AACCATCCCATTTTACAGATGGG + Intergenic
1183273596 22:36877463-36877485 TAACCTCCCATTGTACAGATGGG - Intronic
1185058598 22:48593773-48593795 TACTGTCCCATTTCACAGATCGG - Intronic
1185086112 22:48742026-48742048 TCCTATCCCGTGTTACAGACGGG + Intronic
949783747 3:7718126-7718148 CATTCTCCCATTTTGCAGATGGG - Intronic
950082860 3:10235737-10235759 AAGCCTCCCATTTTACAGAAGGG + Intronic
950165402 3:10793517-10793539 TATTATCCCATTTTACAGATGGG + Intergenic
950184279 3:10935422-10935444 GGTTATCCCATTTTACAGACAGG - Intronic
950450014 3:13060223-13060245 TACTCTCCCATGGTGCTGACTGG - Intronic
950563628 3:13750755-13750777 TGCTCTCCCATTGTGCAGATGGG - Intergenic
950672239 3:14534254-14534276 GACACCCCCATTTTACAGAGGGG - Intronic
951506659 3:23453977-23453999 TACTCTTTAATTTTACAGAAGGG + Intronic
952308287 3:32164576-32164598 TCCAGTCCCATTTTACAGATGGG + Intronic
952314319 3:32219302-32219324 TACATCCCCATTTTTCAGACAGG + Intergenic
952534898 3:34298835-34298857 TATTTTCCTATTTTACAGAGAGG + Intergenic
952544301 3:34402015-34402037 TATTCTCACATTTTACAGATAGG - Intergenic
952859619 3:37802160-37802182 TCCACACCCATTTTACAGAGGGG - Intronic
953297439 3:41734377-41734399 AACTCTCCCATCTCCCAGACTGG - Intronic
953710798 3:45268680-45268702 TACTACCCCATTTTATAGAAGGG - Intergenic
953741840 3:45545122-45545144 TCCCATCCCATTTTACAGATAGG - Intronic
953910325 3:46889549-46889571 CACATCCCCATTTTACAGACAGG - Intronic
954957793 3:54537400-54537422 TACACCCCCATTTCACAGAGAGG - Intronic
955039103 3:55297713-55297735 AATTTTCCCATTTTACAGACAGG - Intergenic
955326859 3:58015195-58015217 TGCTCTTGCATTTTATAGACAGG - Intronic
955515417 3:59721634-59721656 TATTATCCCATTTTACAGATAGG - Intergenic
955827219 3:62961289-62961311 TACTGCCCCATTTTATATACAGG + Intergenic
955962425 3:64354639-64354661 TACTATTCCATTTTACTGATGGG + Intronic
956133433 3:66075655-66075677 TATTCTCTCCTGTTACAGACAGG - Intergenic
956428458 3:69160706-69160728 TAGACGCCCATTTTACAGATGGG - Intergenic
956444879 3:69316391-69316413 AACATCCCCATTTTACAGACAGG + Intronic
956676407 3:71737090-71737112 TCATCTCCCACTTTACACACCGG + Intronic
958888317 3:99753912-99753934 AGCTCTACCATTTTACTGACTGG - Intronic
960577238 3:119241193-119241215 GACCCTTCCATTTTACAGAGTGG + Intergenic
961664882 3:128488850-128488872 CTCCCTCCCATTGTACAGACTGG + Intronic
961864826 3:129946002-129946024 CACCCTCCCATTTCACAGCCCGG + Intergenic
962100296 3:132334901-132334923 TATTTTCCCATGTTACAGAAAGG - Intronic
962875141 3:139530334-139530356 TACTCTCCCATTTTACAGACAGG - Intronic
963749278 3:149159046-149159068 TACTTTCTCATTATACAGACAGG + Intronic
965472444 3:169111147-169111169 GACTCTCTCATTTTTCAAACAGG + Intronic
967160544 3:186733644-186733666 CAGTCACTCATTTTACAGACGGG - Intronic
967328120 3:188262775-188262797 CAGTCTCTCATTTTACAGATAGG + Intronic
968287981 3:197519291-197519313 CACTCTCCCACTTCACAGATGGG + Intronic
968574757 4:1360439-1360461 TTCCACCCCATTTTACAGACAGG + Intronic
968964226 4:3761426-3761448 AATGCTCCCATTTTACAGACAGG + Intergenic
969044908 4:4329694-4329716 TACTCTCCCACTTCACAGAGGGG - Intergenic
969102176 4:4777409-4777431 TTTACTCCCATTTTACAGAAGGG - Intergenic
969239630 4:5889913-5889935 AATTTTCCCATTTTACAGACAGG + Intronic
969330137 4:6470131-6470153 TTCACTCCCATTTTACAGATGGG + Intronic
970192081 4:13527003-13527025 TTTTCTCCCAATTTACATACAGG + Intergenic
970551896 4:17189950-17189972 TGGTCTCCCTTTTAACAGACAGG + Intergenic
970596098 4:17601641-17601663 TACTATGCCATTTTACATAAGGG - Intronic
970657946 4:18252566-18252588 TACTTTTCCATTTTCCAGGCAGG - Intergenic
971291949 4:25350889-25350911 TGTTATCCCATTTTACAGATAGG - Intronic
971387004 4:26150122-26150144 AACTCTTCCATTTCACAAACAGG + Intergenic
972282266 4:37613929-37613951 TACTTTCCTGTTTTACAGACTGG + Intronic
972406618 4:38752445-38752467 TACACTTTCATTTTACAGAGAGG + Intergenic
972670502 4:41210309-41210331 AGCTCTCTCATTTTACAGATGGG + Intronic
975411275 4:74054108-74054130 TTTTCTCCCATCTTACAGAGTGG + Intergenic
975697816 4:77031033-77031055 TACTTTTCCCATTTACAGACTGG + Intronic
975732655 4:77353012-77353034 TTCAATCCCATTCTACAGACAGG - Intronic
976435109 4:85009086-85009108 TCCTCTCCCAGTTTCCAGACAGG + Intergenic
976746248 4:88406149-88406171 TTCTCTTCCCTTTTACACACAGG - Intronic
977298377 4:95236988-95237010 TACTATGCCATTTTACATAAGGG - Intronic
977324643 4:95559530-95559552 TACTATCCCAATTTATAGACAGG - Intergenic
980287697 4:130802118-130802140 TACCCTCCCATTTTTGAGCCAGG - Intergenic
980965778 4:139519384-139519406 TACTTACTCATTTTACAGATAGG - Intronic
981247743 4:142560083-142560105 TCCTCTCCAATTTCACAGAAGGG + Intronic
981360893 4:143844623-143844645 TACTGTCCCATATTAAATACTGG - Intergenic
981371633 4:143965614-143965636 TACTGTCCCATATTAAATACGGG - Intergenic
981380721 4:144068823-144068845 TACTGTCCCATATTAAATACGGG - Intergenic
981515962 4:145610270-145610292 TGTTATCCCATTTTACATACAGG - Intergenic
982774505 4:159427957-159427979 AACTCTCCCATTTCAGAGACGGG + Intergenic
984241294 4:177222863-177222885 TTCTCCCACATTTTATAGACTGG - Intergenic
984579283 4:181492768-181492790 AACTCTCTCATATTACAGATGGG - Intergenic
984920545 4:184760634-184760656 TATGATCCCATTTTACAGAGAGG + Intronic
985398916 4:189574180-189574202 TTCTCTCCCATTTCCAAGACTGG - Intergenic
985499648 5:234736-234758 TACTCTCCCATTTTATATTAGGG + Intronic
986950518 5:13078363-13078385 TATTATCCCATTTTACAGATGGG + Intergenic
989025722 5:37065292-37065314 GATTCTGCCATTTTACAGCCTGG - Exonic
989520531 5:42395973-42395995 TACTCTGCCATTTTACATAAGGG + Intergenic
990616291 5:57511756-57511778 TTTTCTCCCATTTTACTGATGGG - Intergenic
990868307 5:60403620-60403642 ATGTCCCCCATTTTACAGACAGG + Intronic
992351246 5:75931377-75931399 AAGTATCCCATTTTATAGACAGG - Intergenic
992677504 5:79120334-79120356 TACTCACCCATTTTAGGGGCAGG + Exonic
993648191 5:90484943-90484965 TACTCTTCAATTTTGGAGACAGG - Intronic
993851249 5:93012628-93012650 TACTATCTCATTTTACTGATGGG + Intergenic
994044234 5:95290120-95290142 TATTATCCCATTTCAGAGACTGG - Intergenic
995184177 5:109254312-109254334 TCTTCTCCCATTCTACAGACAGG + Intergenic
995482960 5:112611005-112611027 CACTTGCCTATTTTACAGACTGG - Intergenic
997379435 5:133424803-133424825 TATTCTCCCATTTTCCAGATGGG - Intronic
997585700 5:135041757-135041779 TATTCTCACATTTCACAGATGGG - Intronic
998444404 5:142187525-142187547 CAGCATCCCATTTTACAGACAGG + Intergenic
999001841 5:147932176-147932198 TTCTCTCCCAGTTTAAGGACTGG + Intergenic
999139119 5:149345759-149345781 CACGGCCCCATTTTACAGACGGG + Intronic
999238767 5:150115476-150115498 AACTTTCCCATTTTACATATGGG + Exonic
999362509 5:150997886-150997908 TCCTTTCCCTTTTTACATACAGG - Intergenic
999472521 5:151868158-151868180 AACTCTCTCATTTTACAGAAAGG + Intronic
999505954 5:152196528-152196550 AATTCTATCATTTTACAGACGGG - Intergenic
999513998 5:152282116-152282138 TACTATTCCATTTTACAGTTGGG + Intergenic
999737615 5:154524322-154524344 CACTGTCCCATTTTACAGAGAGG - Intergenic
999807482 5:155096334-155096356 AATTCCTCCATTTTACAGACGGG + Intergenic
999835687 5:155368380-155368402 TATTCTTCCGTTTTACATACAGG + Intergenic
1000191964 5:158919811-158919833 TATTATCCCAATTTACAGATAGG + Intronic
1000278981 5:159765631-159765653 ATCTTTCCCATTTTACAGAAGGG - Intergenic
1001131882 5:169071060-169071082 TTCTCTTACATTTTACAGATGGG - Intronic
1001317281 5:170652838-170652860 TGCTGTCCCATTTTACAGATGGG + Intronic
1001565118 5:172695170-172695192 TACGGTCCCATTTTACAGGGAGG + Intergenic
1001569560 5:172721232-172721254 AACTCTTCCATTTTACAGGTGGG - Intergenic
1001801021 5:174544200-174544222 TATTCACCCATTTTACCGATGGG + Intergenic
1001810533 5:174624382-174624404 GTGTTTCCCATTTTACAGACAGG + Intergenic
1002057518 5:176607091-176607113 CCCTCTCCCATTTCACAGATTGG - Intronic
1002671331 5:180870180-180870202 TACATCCCCATTTTACAGATGGG + Intergenic
1003251510 6:4432682-4432704 CACTCCCCCATTTTCCATACTGG + Intergenic
1004731420 6:18362975-18362997 ATCACTCCCATTTTACAGATGGG - Intergenic
1004979988 6:21012568-21012590 TATTCTCCCATTTTTCAAATGGG - Intronic
1005272400 6:24180094-24180116 TACGTTCCCATTTTACAAATGGG - Intronic
1005303355 6:24492198-24492220 TTCTCCCCCATTTTCTAGACTGG - Intronic
1005685956 6:28253027-28253049 TACTTTCCCTATTTACAGATTGG - Intergenic
1006376141 6:33672711-33672733 AATTCTCCCATTTTACAGATGGG + Intronic
1006444819 6:34074278-34074300 TACCATCCCATTTCACAGATGGG - Intronic
1007262319 6:40572395-40572417 CACTCCCCCATTTAACAGATAGG - Intronic
1007453061 6:41954744-41954766 TATTATCCCATTTTACAGAGAGG + Intronic
1008879801 6:56370360-56370382 AAATCTCACATTTTACAGAGAGG - Intronic
1008945725 6:57094899-57094921 TATTATCCCATTTAACAGATGGG - Intronic
1010702880 6:79073003-79073025 TATTAGCCCATTTTACAGAATGG + Intronic
1011673813 6:89711498-89711520 TACTATCCCATTTTATATAAGGG + Intronic
1011749063 6:90437020-90437042 TACTGTCCCATTTTACATTAGGG + Intergenic
1012474540 6:99605225-99605247 ATCATTCCCATTTTACAGACTGG + Intergenic
1012953852 6:105547446-105547468 TATTAGCCCATTTTACAGATGGG - Intergenic
1015952083 6:138563673-138563695 TATTATCCCATTTTACAGTGTGG + Intronic
1016470803 6:144372323-144372345 TACTATCCCATTTAACAGATGGG - Intronic
1018086525 6:160305735-160305757 AACTAACCCATTTTGCAGACAGG + Intergenic
1018432425 6:163732981-163733003 CATTCTTCCATTTTACAGAAGGG - Intergenic
1018762449 6:166903962-166903984 CGCTGTCCCATTTTCCAGACAGG + Intronic
1018771237 6:166973141-166973163 TCCTTTCCCCTTTTACATACAGG - Intergenic
1019338876 7:498818-498840 CATTCTCCCATTGTACAGATGGG + Intronic
1019350881 7:553451-553473 CACCATCCCATTTTACAGCCGGG + Intronic
1019497966 7:1349317-1349339 CACTCTCCCATGTTACAGGTGGG + Intergenic
1019500258 7:1361008-1361030 TATTATCCCATTTGACAGATGGG - Intergenic
1021239475 7:18182634-18182656 TCTTATCCCATTTTACAGACGGG + Intronic
1022658399 7:32342736-32342758 TATAGTCCCATTTTACAGAATGG - Intergenic
1023117134 7:36873531-36873553 AACACTCCTATTTTACAGATGGG + Intronic
1026011216 7:66638085-66638107 TTTTCTCCAATTTTACAGACAGG + Intronic
1026016472 7:66675141-66675163 TTTTCTCCAATTTTACAGACAGG + Intronic
1026051868 7:66953558-66953580 TACTGTACCATTTTACAGAAGGG - Intronic
1026101861 7:67390368-67390390 AACTCTCCCAGGTTACAGCCTGG - Intergenic
1026967302 7:74448320-74448342 GACTATCCCATTTCACAGATGGG - Intergenic
1026972361 7:74476167-74476189 CGCCATCCCATTTTACAGACAGG - Intronic
1027262294 7:76473507-76473529 AACTCTCCCATTTTGCAGTCAGG + Intronic
1027313675 7:76971604-76971626 AACTCTCCCATTTTGCAGTCAGG + Intergenic
1028477689 7:91267968-91267990 AACATTTCCATTTTACAGACCGG - Exonic
1028612441 7:92726866-92726888 TACTGTCCCATTTTACAGACAGG - Intronic
1028927786 7:96378345-96378367 TAATCTCCCATGTTAGAGGCGGG - Intergenic
1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG + Intronic
1030232145 7:107219999-107220021 TACATCCCCATTTTACAGATGGG + Intronic
1033823832 7:145165041-145165063 TACTCTCCCATTTCGCAGTGTGG + Intergenic
1034348969 7:150404477-150404499 TTTTATCCCATTTTATAGACGGG - Intronic
1036131637 8:6120365-6120387 TATTATGCCATTTTACATACGGG + Intergenic
1037052052 8:14385884-14385906 TACTATGCCATTTTACATAAAGG - Intronic
1038368857 8:26967483-26967505 AACACCCCCATTTTACAGATAGG + Intergenic
1038721328 8:30038563-30038585 TTCCCTCCCATTTTAGAGACAGG - Intergenic
1039385324 8:37130395-37130417 CTCTCACCCATTTTACAGAGAGG - Intergenic
1039984327 8:42435466-42435488 TTTTCCCCCATTTTACAGATTGG + Intronic
1042264575 8:66895070-66895092 TACTCTGCCATTTTATATAAGGG - Intronic
1044788393 8:95820907-95820929 TACTATACCATTTTACATAAGGG - Intergenic
1044898231 8:96915864-96915886 TCCTCTCCCACTTTGCATACAGG + Intronic
1046541352 8:115587386-115587408 GGCTCTCCCATTTTAGAGTCTGG + Exonic
1047167550 8:122456612-122456634 TCTTATCCCATTTTACAGATGGG + Intergenic
1047486569 8:125336333-125336355 TCTTCTCCCATTTTACAGATGGG + Intronic
1047863887 8:129000439-129000461 TACCCACCCATTGTAAAGACTGG - Intergenic
1048165100 8:132055275-132055297 TACATTTCCATTTTACAGATGGG - Intronic
1048976011 8:139673552-139673574 CACTGGCCCATTTTACAGATAGG + Intronic
1050691822 9:8236124-8236146 TAATCTCTCCTTTTACATACAGG + Intergenic
1051408964 9:16769394-16769416 TTCTCTCCCATTTTACTGACAGG + Intronic
1051930319 9:22377361-22377383 AATTTTCCCATTTTACAGATTGG - Intergenic
1052839409 9:33279300-33279322 TGCTCTCACATTTTACAGGTAGG - Intronic
1052927066 9:34026731-34026753 TTTACTCCCATTTTACAGAGAGG + Intronic
1053295832 9:36912346-36912368 TGCTGGCCCATTTTACAGATGGG + Intronic
1053318438 9:37073231-37073253 AACTCTCTCATTTTGCAGAAGGG - Intergenic
1053322509 9:37112618-37112640 AACTCTCTCATTTTGCAGAAGGG - Intergenic
1053446933 9:38159774-38159796 TACTCTCCCATTGTACAAATGGG + Intergenic
1053576224 9:39358906-39358928 TTCTCTCCCATGTTCCAGAAGGG - Exonic
1053840742 9:42186843-42186865 TTCTCTCCCATGTTCCAGAAGGG - Exonic
1054097794 9:60917597-60917619 TTCTCTCCCATGTTCCAGAAGGG - Intergenic
1054119196 9:61193227-61193249 TTCTCTCCCATGTTCCAGAAGGG - Exonic
1054588557 9:66989335-66989357 TTCTCTCCCATGTTCCAGAAGGG + Intergenic
1054769875 9:69073696-69073718 TATTCTCTCATTTAACAGATGGG - Exonic
1055799188 9:80014123-80014145 TACTGTGCCATTTTACATAAGGG - Intergenic
1056947284 9:91009290-91009312 TACTCCCTGATTTTACAGATGGG - Intergenic
1057027709 9:91747528-91747550 AACTCTCCATTTATACAGACAGG + Intronic
1057146599 9:92763466-92763488 TGCACTCCCATTTTGCAGAGGGG + Intronic
1057160587 9:92885700-92885722 TTCTCTCCCATGTTCCAGAAGGG - Intergenic
1057488271 9:95503663-95503685 GATTGTCCCATTTTACAGATGGG - Intronic
1057505810 9:95632538-95632560 TACACTCCCATTTCCAAGACAGG - Intergenic
1057746476 9:97756041-97756063 AACTCCCTCATTTTACAGATAGG - Intergenic
1057755438 9:97831484-97831506 TCCTCTTCCATAATACAGACAGG - Intergenic
1057943279 9:99303415-99303437 TAATTCCCCATTTTACAGATGGG - Intergenic
1058074525 9:100637501-100637523 TAGTCTTCCTTTTAACAGACAGG + Intergenic
1058354687 9:104070216-104070238 TTCTCTCCCATTTTAAAGAAAGG + Intergenic
1058591683 9:106572033-106572055 TGTTATCCCATTTTACAGATGGG - Intergenic
1058824253 9:108760688-108760710 TATTATCCCATTTTACAGGCAGG + Intergenic
1058939825 9:109802629-109802651 TCCTCTCTCATTTGACAGGCTGG - Intronic
1059416757 9:114167345-114167367 TACTATCCCATTTAATAGATGGG + Intronic
1059426089 9:114221885-114221907 TTCACGCTCATTTTACAGACAGG - Intronic
1059446657 9:114342381-114342403 CACTCCCCCACTTTACAGATGGG + Intronic
1059656053 9:116358480-116358502 TATTGCCCCATTTTACAGATGGG + Intronic
1059723544 9:116984795-116984817 TACCCACTCATTTTACAGATGGG - Intronic
1060074451 9:120579341-120579363 TACTAGCCCATTTTACAGATGGG + Intronic
1060084256 9:120682331-120682353 TACTGTCCCTGTTTACAGAGAGG + Intronic
1060186247 9:121565902-121565924 GGTTCTCCTATTTTACAGACGGG - Intergenic
1060195412 9:121620478-121620500 TGTTATCCCATTTTACAGATGGG - Intronic
1060440628 9:123635916-123635938 TAGTCTCTTATTTTACATACAGG - Intronic
1060745537 9:126128519-126128541 TATTATCCCATTTTACAGATAGG - Intergenic
1060881216 9:127119550-127119572 TAGCATCCCATTTTACAGATGGG - Intronic
1061409226 9:130409693-130409715 ATCACTCCCATTTTACAGAAGGG + Intronic
1061780436 9:132992947-132992969 CATTCTCCCATTTTACAGATGGG + Intergenic
1061895151 9:133643306-133643328 ATCCCTCCCATTTTACAGATGGG + Intronic
1062000123 9:134211690-134211712 TAGGCACCCATTTTACAGATGGG + Intergenic
1203775942 EBV:73301-73323 TCCTCTGCCATTTTGCAGACAGG - Intergenic
1185856729 X:3543095-3543117 GATTCTACCATTTCACAGACTGG - Intergenic
1187310681 X:18138251-18138273 TATTATCCCATTTTACAGATGGG - Intergenic
1187660661 X:21543715-21543737 TACTATTCCATTTTACAGACAGG - Intronic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1189826798 X:44926937-44926959 TATTCTCTCATTTTACAGACTGG - Intronic
1190337820 X:49273235-49273257 AACTGTCGCATCTTACAGACAGG - Intronic
1192212145 X:69134420-69134442 TTCACCCCCATTTTACAGATAGG - Intergenic
1192578200 X:72259600-72259622 TATTATCCCCTTTTACAGATGGG + Intronic
1193601715 X:83514647-83514669 TACTCTTTTATTTTACAGAATGG - Intergenic
1194381600 X:93198758-93198780 TTTTCTCCTTTTTTACAGACTGG - Intergenic
1195783700 X:108492569-108492591 GACTCTCCCATACTACAGCCAGG - Intronic
1197297528 X:124737234-124737256 TACTCTCCCACTTGGCAGTCAGG + Intronic
1197793826 X:130280587-130280609 TCCTTTCCCCTTTTACATACAGG + Intergenic
1199021810 X:142887917-142887939 TAGTATCCCATTTTACAGAAAGG + Intergenic
1199577698 X:149329467-149329489 TACTTGCCCATTTCACAGATGGG + Intergenic
1199726414 X:150587042-150587064 GTCACACCCATTTTACAGACTGG + Intronic
1199879706 X:151964214-151964236 TAGTCTCCCATTTAACAAAGAGG - Intronic
1200961817 Y:9002831-9002853 AACTCTCACATTTTAATGACTGG + Intergenic
1202178903 Y:22122640-22122662 CACTGTCACATTTTAAAGACTGG - Intergenic
1202212458 Y:22463754-22463776 CACTGTCACATTTTAAAGACTGG + Intergenic