ID: 962876606

View in Genome Browser
Species Human (GRCh38)
Location 3:139540016-139540038
Sequence CTAAAGCCTCGCGCCGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962876598_962876606 30 Left 962876598 3:139539963-139539985 CCTGGGGTTTGTGCTGGCGTGAT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 962876606 3:139540016-139540038 CTAAAGCCTCGCGCCGGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
962876602_962876606 -5 Left 962876602 3:139539998-139540020 CCACTTACAGGCCTTTGTCTAAA 0: 1
1: 0
2: 0
3: 9
4: 214
Right 962876606 3:139540016-139540038 CTAAAGCCTCGCGCCGGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962876606 Original CRISPR CTAAAGCCTCGCGCCGGTGG TGG Intergenic
900616038 1:3566083-3566105 CTAAAGTCTCCAGCCGGTGCTGG - Intronic
920679188 1:208059844-208059866 CTAAAGGCTGGCTCCGGTGGGGG + Intronic
1065533621 10:26697710-26697732 CCATGGCCTCGCGCTGGTGGCGG + Exonic
1067135823 10:43606578-43606600 CTGAAGCCTCGAGCCCCTGGCGG + Intronic
1073275917 10:102311284-102311306 CTTAAGGCTCACGCCAGTGGTGG - Intronic
1082003660 11:47408433-47408455 CTTCCGCCTCGCGGCGGTGGGGG - Intronic
1090327858 11:125904459-125904481 GCACCGCCTCGCGCCGGTGGTGG + Exonic
1097029293 12:56080026-56080048 CTCCAGCCTCGCGCGGGAGGGGG + Exonic
1101489476 12:105197914-105197936 ATAAAGCCTCTCCCAGGTGGTGG + Exonic
1107033715 13:35879317-35879339 CTAGAGCCCCGTGCAGGTGGAGG - Intronic
1126109419 15:45166958-45166980 CGGAAGCCGCGCGCCGGCGGAGG - Intergenic
1160960634 19:1719142-1719164 CTGCAGCCTCGCGTGGGTGGGGG - Intergenic
1179218220 21:39385311-39385333 CTAAGGCCTCACGCGGGGGGAGG - Intronic
1184207717 22:43015390-43015412 CCAAAGCCGCTCGCTGGTGGTGG + Intergenic
962876606 3:139540016-139540038 CTAAAGCCTCGCGCCGGTGGTGG + Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
1024276893 7:47684785-47684807 CGAAAGCCTCACTCTGGTGGAGG - Intergenic
1037614733 8:20508509-20508531 CTGAAGCCTGACACCGGTGGGGG + Intergenic
1049941414 9:549786-549808 GTAAATCCTCACGCAGGTGGCGG + Intronic
1187391807 X:18891061-18891083 CTGGAGCCTCGAGCCGGGGGTGG - Intergenic