ID: 962878301

View in Genome Browser
Species Human (GRCh38)
Location 3:139552933-139552955
Sequence CAGAGCACAGGGAAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962878301_962878311 4 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878311 3:139552960-139552982 TGGCAATCTGGGGCAATCTGAGG No data
962878301_962878306 -8 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878306 3:139552948-139552970 GTGCTCTGACCCTGGCAATCTGG No data
962878301_962878314 17 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878314 3:139552973-139552995 CAATCTGAGGCCCAGGGCCTTGG No data
962878301_962878307 -7 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878307 3:139552949-139552971 TGCTCTGACCCTGGCAATCTGGG No data
962878301_962878308 -6 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878308 3:139552950-139552972 GCTCTGACCCTGGCAATCTGGGG No data
962878301_962878313 11 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878313 3:139552967-139552989 CTGGGGCAATCTGAGGCCCAGGG No data
962878301_962878312 10 Left 962878301 3:139552933-139552955 CCTGGCCACTTCCCTGTGCTCTG No data
Right 962878312 3:139552966-139552988 TCTGGGGCAATCTGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962878301 Original CRISPR CAGAGCACAGGGAAGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr