ID: 962879016

View in Genome Browser
Species Human (GRCh38)
Location 3:139558810-139558832
Sequence CATGATGCACACATGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962879013_962879016 -9 Left 962879013 3:139558796-139558818 CCTGGTAGGGGCTGCATGATGCA 0: 1
1: 0
2: 0
3: 18
4: 155
Right 962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962879016 Original CRISPR CATGATGCACACATGGATCA GGG Intergenic
906725032 1:48037995-48038017 CATGTTGTACACATGTATCCTGG + Intergenic
908247971 1:62242987-62243009 CATGCTGCCCACCTGGGTCAGGG - Intronic
910108580 1:83657773-83657795 CATGATGCTGACATGGCTTAGGG - Intergenic
916411178 1:164548686-164548708 CATGAAGGACACATGGAGGACGG - Intergenic
917139827 1:171824791-171824813 CCTGATGCAGACATTGACCAGGG + Intergenic
920668583 1:207985271-207985293 CATGATTTACACATGGATAAAGG - Intergenic
920789045 1:209071227-209071249 CATGATGCAGACAGGCTTCAGGG + Intergenic
923821280 1:237445413-237445435 CATGAAGGCCACATGGATGATGG + Exonic
1067660117 10:48230530-48230552 CTTGATGCACTTATGCATCAAGG + Intronic
1075817033 10:125272243-125272265 GATGATGGACACATGGATGCTGG + Intergenic
1075818133 10:125282312-125282334 GATGATGGACACATGGATGCTGG - Intergenic
1076611518 10:131728933-131728955 CAGGATGTACACTTGGCTCACGG - Intergenic
1079278651 11:19067325-19067347 CCTGATGCACACTTGGCTCTGGG - Intergenic
1079850992 11:25534150-25534172 CATGATCCAATCATGGAGCAAGG + Intergenic
1080637967 11:34140149-34140171 CATACTGAACACATGGACCAAGG - Intronic
1084414042 11:69020451-69020473 CATGACCCAGATATGGATCAAGG - Intergenic
1087270953 11:96111104-96111126 ATTGATGCAGAGATGGATCAAGG - Intronic
1087516481 11:99168955-99168977 CATGATGCTCACCTGGAACATGG + Intronic
1088371081 11:109089262-109089284 CATGATGCAAAGACGAATCATGG + Intergenic
1091268506 11:134289253-134289275 CATTAAGCAGAAATGGATCATGG + Intronic
1093269204 12:17038030-17038052 AATGATACACACTGGGATCAAGG - Intergenic
1095308479 12:40665714-40665736 CATTTTGCAGCCATGGATCAAGG + Intergenic
1095735796 12:45555038-45555060 CATGATGCACATTTTGATAAGGG + Intergenic
1096932860 12:55234369-55234391 AATGATGCACACATGTTGCAAGG - Intergenic
1100227291 12:92572044-92572066 CATGAAGCCCACAGGGACCAGGG + Intergenic
1101894529 12:108745941-108745963 CAGGTTGCACACTTGGCTCAGGG + Intergenic
1102579889 12:113879667-113879689 CATTATGGATACAGGGATCAAGG - Intronic
1103646394 12:122396822-122396844 AGTGATGCACTCATGGCTCATGG + Intronic
1104160048 12:126169418-126169440 CATGATGCTGACATGGGACACGG + Intergenic
1105324951 13:19362203-19362225 CATTCTGCAGCCATGGATCAAGG - Intergenic
1105338054 13:19493256-19493278 CATGATGGAAACATAGACCAAGG - Intronic
1106085499 13:26538306-26538328 CATCAAGCACACATGTACCAAGG - Intergenic
1107929311 13:45293879-45293901 CAGAACGCACACATGGTTCATGG + Intergenic
1108009671 13:45992747-45992769 GATGATACACACATTGGTCAGGG - Intronic
1109656391 13:65396555-65396577 GAAGAAGCACACATGAATCATGG - Intergenic
1110699949 13:78535397-78535419 CATGGACCTCACATGGATCAGGG + Intergenic
1118791399 14:69096525-69096547 CATGAAGCACATATGGATGGCGG + Intronic
1120617265 14:86722817-86722839 CATGTTCCACAGATAGATCAAGG - Intergenic
1122367210 14:101201212-101201234 CACGAGGCACGCCTGGATCAAGG - Intergenic
1127699106 15:61479797-61479819 CATGATTCAAACATGAGTCATGG + Intergenic
1127913861 15:63439706-63439728 CTTGATGCACACAGTGACCAAGG + Intergenic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1131659972 15:94503838-94503860 TATAACGCACACATGAATCAAGG + Intergenic
1131773291 15:95764674-95764696 GATGGTGCAAAAATGGATCAAGG - Intergenic
1133976020 16:10600447-10600469 GATGATGCAAAAAGGGATCAAGG - Intergenic
1134399622 16:13897492-13897514 CATCATGCACACAGGCCTCAGGG - Intergenic
1142734076 17:1883556-1883578 AATGATGCAATCATGGCTCAAGG - Intronic
1144254040 17:13447984-13448006 CAGGATGCACCCCTGGGTCAGGG - Intergenic
1146780257 17:35664400-35664422 CATGCTGCACACATGGCTAATGG + Intronic
1147447881 17:40486009-40486031 CATGACGCTCACAGGCATCAAGG - Intronic
1150016811 17:61565396-61565418 CATGCTGCACATATGCACCATGG - Intergenic
1150621238 17:66809170-66809192 CCTGACGCACACATGGATGAAGG + Exonic
1153757294 18:8297151-8297173 CTTGATGCAGTCATGGATGACGG - Intronic
1153945031 18:10010440-10010462 CATTATGGGCACATAGATCATGG + Intergenic
1155187644 18:23401550-23401572 CATTAAGCTCACATGAATCAAGG + Intronic
1165072785 19:33265210-33265232 CATGGTTCACACAGGGAGCATGG + Intergenic
1168431262 19:56282735-56282757 CATGGTCCGCACATGGCTCAAGG + Intronic
925556741 2:5139407-5139429 CATCCTGCAGACATGGATCAAGG + Intergenic
925783894 2:7409208-7409230 CATGCTGCACACAGAGCTCAAGG - Intergenic
926552513 2:14317239-14317261 CAGTATGCTCACATGGCTCAAGG + Intergenic
926772360 2:16389723-16389745 CAGGCTGGACACATGGCTCAGGG - Intergenic
929822605 2:45285367-45285389 CATGATGAACACTGGGCTCAAGG - Intergenic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
931107704 2:59074942-59074964 CATGATATACACATAGACCAGGG - Intergenic
931193955 2:60032774-60032796 CATGATGCAGACAAGGTTCATGG + Intergenic
931463820 2:62469991-62470013 CATGCTGGACATGTGGATCAAGG - Intergenic
932967814 2:76498539-76498561 CATGATGCAGACAGGGATCTGGG - Intergenic
935738634 2:106126978-106127000 GATGATACACAAATGGAACACGG + Intronic
935832145 2:107011363-107011385 AATGATGCACACAATGATGATGG + Intergenic
937037202 2:118792116-118792138 CAAGATACACCCATGGAGCAAGG + Intergenic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
939189132 2:138895818-138895840 TATGATGCACACCAGCATCATGG - Intergenic
939486495 2:142818851-142818873 CATTCTGCAGCCATGGATCAAGG - Intergenic
941175632 2:162194700-162194722 CATGATGGACGCACTGATCAAGG - Exonic
942062036 2:172236252-172236274 CAAGAGGCACACATGTACCAAGG - Intergenic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
944765297 2:202858253-202858275 AATGAGGCACATATGCATCAAGG + Intronic
947666498 2:231909184-231909206 CATAATGCAGACATGGATGCTGG - Intergenic
1170979220 20:21195554-21195576 CAGGATGCAAACCTGGAGCAAGG - Intronic
1177591562 21:23176343-23176365 CAGGAAGCTCACAGGGATCAAGG - Intergenic
1181547374 22:23609744-23609766 CCTGATGCAAACAGGGATGAAGG - Intronic
1184877125 22:47282970-47282992 CATGATGTCCACCCGGATCATGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950725687 3:14915427-14915449 CATGATGCTGACATGAACCAAGG - Intronic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
955327351 3:58019550-58019572 CATGATGCAGGCAGGGATTAGGG - Intronic
957833667 3:85556003-85556025 CTTGAAGAACACAAGGATCAGGG + Intronic
959324313 3:104917506-104917528 CATGATGTATACATTGATCCAGG - Intergenic
959702074 3:109308124-109308146 CATGATGCCAACATGGCTCCCGG + Exonic
961758246 3:129144579-129144601 CATGATGCACTAATGGGTCTTGG - Intronic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
963042870 3:141082137-141082159 CCAGATGCACACATGTGTCAGGG - Intronic
963611506 3:147474442-147474464 AGTGATGCAAACATGGCTCACGG - Intronic
964510657 3:157447326-157447348 GACAATGCACATATGGATCAAGG - Intronic
966134326 3:176681284-176681306 CATGTTCCACACATGTATCCTGG + Intergenic
970137626 4:12943197-12943219 CATGAAGGACACATGGTCCATGG + Intergenic
972979671 4:44680492-44680514 ATTGTTGCACACGTGGATCATGG + Exonic
988669687 5:33367802-33367824 CATTCTGCAACCATGGATCAAGG - Intergenic
995037139 5:107547142-107547164 CCTACTGTACACATGGATCATGG + Intronic
995056788 5:107768464-107768486 CATTCTGTACCCATGGATCAAGG - Intergenic
998896449 5:146805222-146805244 CTTCATGCACAAATGGCTCAGGG - Intronic
999581241 5:153040581-153040603 CATGTTCTACACATGTATCATGG + Intergenic
999884598 5:155907337-155907359 AATTATGCACCCATGGATCAAGG + Intronic
1001277986 5:170364813-170364835 CTTGATACACACATAGATAATGG + Intronic
1005797891 6:29386959-29386981 CATGAAGCACAAATTGGTCAAGG - Intronic
1006373791 6:33660540-33660562 CATCATCCACACATTAATCAAGG + Intronic
1007684964 6:43660919-43660941 CATCCTGCAGCCATGGATCAAGG - Intronic
1007967265 6:46014804-46014826 CCTGATGCAGACAGGGATGAAGG - Intronic
1008693474 6:54006978-54007000 CATGATGGACACCTGACTCATGG + Intronic
1009725458 6:67531540-67531562 CAGGATGCACCCATGAAACAGGG + Intergenic
1012942805 6:105433857-105433879 CAGGATTCACTCATGGATCAAGG - Intergenic
1015838763 6:137452985-137453007 CATTATGAACTCATGGATAACGG - Intergenic
1017110005 6:150923400-150923422 TATTATGCACACCTGGATAATGG - Intronic
1020139532 7:5605089-5605111 CATGATGGACACATGAACAAGGG - Intronic
1020758562 7:12238631-12238653 CATTCTGCAGCCATGGATCAGGG - Exonic
1021631282 7:22649836-22649858 CATGGTGTACACATTAATCAAGG - Intergenic
1021943352 7:25701633-25701655 GATGAAGCCCACTTGGATCATGG + Intergenic
1023347375 7:39285293-39285315 CATGATGCACAGATTGACAAAGG + Intronic
1023803788 7:43856932-43856954 CATGATCTACACATGGATTATGG + Intergenic
1028853134 7:95559052-95559074 CATGATGCAATAAGGGATCAAGG - Intergenic
1035452582 7:158987772-158987794 GATGATGCATAGATGGATGAAGG - Intergenic
1039459620 8:37732648-37732670 TATAATGAACACATGCATCATGG - Intergenic
1040531333 8:48268872-48268894 CATGATGCACCCATGGTTTCTGG - Intergenic
1043722319 8:83560462-83560484 AGTGATGCACAGATGGGTCAGGG + Intergenic
1045271515 8:100666021-100666043 CATCATGCATACATGAATCTGGG + Intergenic
1046051724 8:109030898-109030920 CATGAGGCAGATATTGATCAAGG - Intergenic
1048777647 8:137965168-137965190 CATGATGGGCAAATGGATAAAGG + Intergenic
1049701359 8:144014787-144014809 CGTGAGACACACATGGGTCAGGG - Intronic
1052924932 9:34007437-34007459 AATGATGCGAACATGGCTCACGG - Intronic
1053320651 9:37095549-37095571 AATGGTGCAAACATGGCTCATGG - Intergenic
1053645629 9:40118140-40118162 CCTGATGTACACATGGAGCCTGG - Intergenic
1053760080 9:41345369-41345391 CCTGATGTACACATGGAGCCTGG + Intergenic
1054326644 9:63716041-63716063 CCTGATGTACACATGGAGCCTGG - Intergenic
1054538944 9:66257832-66257854 CCTGATGTACACATGGAGCCTGG + Intergenic
1054795713 9:69299763-69299785 CATTCTGCACCCATGGATCAAGG - Intergenic
1058597991 9:106636478-106636500 CATGATGTACAACTGGAACATGG + Intergenic
1058806365 9:108595901-108595923 CACTATGAACAAATGGATCAGGG + Intergenic
1059464420 9:114458713-114458735 CATGATGCAGACACAGATCTAGG - Intronic
1061630827 9:131871130-131871152 CAGGACGCACACCTGGATCCAGG - Intronic
1186884607 X:13900636-13900658 GATTATGCACACATTGTTCATGG + Intronic
1187038420 X:15566786-15566808 CGTGTTGCACCCATGGATGAAGG + Intronic
1187868459 X:23744522-23744544 CATGAGTTACACATGGAGCATGG + Intronic
1190054040 X:47171554-47171576 CATGATGCACACATGCAAAATGG - Intronic
1192298667 X:69878008-69878030 CAGAATGAACACATAGATCAAGG - Intronic
1198730372 X:139721674-139721696 CATGATGCAGATAGGGATAATGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1200743065 Y:6876606-6876628 CCTGAGGCTTACATGGATCAAGG - Intergenic
1200745095 Y:6897214-6897236 CATGATGCACAGAAGAATGATGG + Intergenic