ID: 962879427

View in Genome Browser
Species Human (GRCh38)
Location 3:139562256-139562278
Sequence GTGTGGCATTTGTAACTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962879420_962879427 -3 Left 962879420 3:139562236-139562258 CCCAGGCAGCCATCCTCCAGGTG 0: 1
1: 1
2: 1
3: 42
4: 273
Right 962879427 3:139562256-139562278 GTGTGGCATTTGTAACTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 126
962879421_962879427 -4 Left 962879421 3:139562237-139562259 CCAGGCAGCCATCCTCCAGGTGT 0: 1
1: 0
2: 3
3: 19
4: 230
Right 962879427 3:139562256-139562278 GTGTGGCATTTGTAACTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962879427 Original CRISPR GTGTGGCATTTGTAACTGCT GGG Intronic
901332388 1:8421032-8421054 ATCTGGCATTTGGAAATGCTCGG - Intronic
901787059 1:11631761-11631783 TTGGGGCATTTTTAACTGCTTGG - Intergenic
910653086 1:89590940-89590962 GAGTGGCACTGGTAACTGGTGGG + Intronic
910746346 1:90579105-90579127 GTGTGACATTTGAATCTCCTGGG + Intergenic
920841177 1:209555272-209555294 GTATGGCATTAGTCACTGGTTGG - Intergenic
923997022 1:239506728-239506750 CTGTGGCTTTTGTAGGTGCTTGG - Intronic
1064801495 10:19079470-19079492 GTGTGCCATATGTATCTGTTAGG + Intronic
1064813020 10:19223280-19223302 GACTGCCATTTGGAACTGCTGGG + Intronic
1067293720 10:44962503-44962525 GTGTGCCACATGTCACTGCTGGG - Intronic
1070735203 10:78859309-78859331 GTTTGCCATTTGTAAATTCTGGG - Intergenic
1072223315 10:93345958-93345980 GTGTAGCATTTGTACCCTCTGGG + Intronic
1073938109 10:108659373-108659395 TTGTGGAATTTCTGACTGCTAGG + Intergenic
1074318533 10:112380193-112380215 CTGTGGGATTTGTCACTTCTGGG + Intronic
1075370840 10:121933515-121933537 TTTTGGCATTTGTGCCTGCTTGG - Intergenic
1076052844 10:127349119-127349141 GTGAGGCATTTTTAACTTCATGG - Intronic
1079732942 11:23958957-23958979 GTGTGGCATTTGTCCCTCCTGGG + Intergenic
1084105560 11:66977907-66977929 GTGTGACAATTAGAACTGCTGGG - Intergenic
1084649500 11:70480506-70480528 TTGTGGCATTTGTCACAGTTTGG + Intronic
1087321015 11:96658386-96658408 GTGTGGAATTTATAATGGCTGGG - Intergenic
1088493344 11:110407533-110407555 GTGTGGCATCAGCATCTGCTTGG - Intergenic
1090342314 11:126035108-126035130 GTGAGTCTTTTGTAACTGCCAGG - Intronic
1090726750 11:129534011-129534033 GAGTGGCATTTGGTCCTGCTGGG - Intergenic
1091553162 12:1552211-1552233 GTGCCACATTTATAACTGCTTGG - Intronic
1091877084 12:3944289-3944311 GAATGGCATTTGCAACTTCTGGG + Intergenic
1092448196 12:8577415-8577437 GTGAAGCATTTAGAACTGCTTGG + Intergenic
1099044813 12:77704289-77704311 GTGTGGCATTTATAAATAATTGG + Intergenic
1100195638 12:92241445-92241467 GTGTGCCATTTGTTCTTGCTAGG - Intergenic
1100950818 12:99847499-99847521 GTGAGGCATTTGTTCCTTCTGGG - Intronic
1101397804 12:104363740-104363762 TTCTGGCATTGCTAACTGCTCGG + Intergenic
1101520031 12:105474129-105474151 CTGTGGCATTTGAAGCTGCTGGG + Intergenic
1102472139 12:113165349-113165371 GTGAGCCATCTGTAAGTGCTAGG + Intronic
1106218367 13:27722929-27722951 GTTTGGCAGTTGTACATGCTTGG + Intergenic
1110235263 13:73211367-73211389 GTGGGGCATTTGCCACAGCTGGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112720481 13:102238249-102238271 TTGTGGCATTTGTTAATCCTTGG - Intronic
1113088084 13:106588599-106588621 GGGTGGCACTGGTAGCTGCTAGG - Intergenic
1113506257 13:110818776-110818798 GTGTGGCATCTGTAAATACATGG - Intergenic
1116182233 14:41549780-41549802 GTGTGGCATTTCTTCCTCCTAGG + Intergenic
1117354489 14:54910891-54910913 ATGTGGCCATTGTAACTGCAGGG - Intergenic
1117356593 14:54929860-54929882 ATGTGGCATTTGTAGCTATTGGG - Intergenic
1118055616 14:62076711-62076733 GTGTGGGATTTGATACGGCTTGG - Intronic
1122803737 14:104246360-104246382 CTGTGGAAAATGTAACTGCTAGG - Intergenic
1124028431 15:25988254-25988276 ATGTGCCATTTCTAACAGCTGGG + Intergenic
1128423190 15:67514303-67514325 GAGTGGCATTTGCCACTGGTGGG + Intergenic
1128435319 15:67642149-67642171 GTGTGGCATTTTTATTTGTTTGG + Intronic
1129108850 15:73325845-73325867 CTGTGCCAGTTGTCACTGCTGGG - Intronic
1132196423 15:99917604-99917626 GTTTGGCCTTTCTAACTCCTTGG - Intergenic
1133772222 16:8873739-8873761 GAGTGGCATTTATCACAGCTAGG + Intergenic
1138103109 16:54270314-54270336 CTGTGGCCTTGGTAGCTGCTGGG - Intronic
1139184834 16:64793836-64793858 TTGTGGCATCTGTAACAGCTGGG - Intergenic
1146636213 17:34507416-34507438 GTCTGGGATTTGTTCCTGCTGGG - Intergenic
1146884670 17:36463198-36463220 GTCTGGCATCTCCAACTGCTAGG - Intergenic
1148616921 17:49007636-49007658 GAGTGGCATTTGGGATTGCTTGG + Intronic
1148763052 17:50018544-50018566 GTCTGTCATTTTTAAATGCTTGG - Intergenic
1156978182 18:43251627-43251649 TTGTAGAATTTGTAACTGATGGG - Intergenic
1159966652 18:74601554-74601576 GTGTGGCACTGGCATCTGCTGGG + Intronic
1163821223 19:19497665-19497687 GTGTGGCATTTGCAAGTCATTGG + Intronic
1168397860 19:56064209-56064231 GTGGGATATTTGTAACTGTTGGG - Intergenic
1168569365 19:57452453-57452475 GTATGGCACTGGTATCTGCTTGG - Intronic
1168717608 19:58538565-58538587 GTGTGGCCTTTGTTCCTGATGGG - Intronic
925855621 2:8126429-8126451 GTGTGGCATTTATAAGAGCAAGG - Intergenic
927369504 2:22338240-22338262 GCTTAGCATTTGTAACTGTTGGG + Intergenic
928601892 2:32911756-32911778 GTGTGGTATTTGTGTCTGTTGGG + Intergenic
929704783 2:44198840-44198862 GTCTGGCATTTGTAATTACTAGG + Intronic
929810123 2:45182710-45182732 GGGTGCCATGTGCAACTGCTGGG - Intergenic
931240871 2:60451392-60451414 GTTTGGTATTTTTTACTGCTTGG - Intronic
935056808 2:99574745-99574767 GTGTGGCATCTGTTACTTTTTGG + Intronic
935417547 2:102834787-102834809 GCTTGGCTTTTGTAACAGCTTGG - Intronic
937541159 2:122955945-122955967 GGGTGTCATGTGTAACAGCTGGG - Intergenic
938727873 2:134122625-134122647 GTCTGGCATTTGCCTCTGCTGGG + Intronic
940698578 2:157012372-157012394 TTGTGGCATTGATAACTCCTGGG - Intergenic
941968060 2:171320061-171320083 GCGTTGCAAATGTAACTGCTTGG - Exonic
943702684 2:191003825-191003847 CTGTGGGCTTTGTAACAGCTGGG + Intronic
948086407 2:235253475-235253497 GTGAGGCATTTCAAAGTGCTGGG - Intergenic
1169916720 20:10690703-10690725 ATTTGGGATTTGTAATTGCTTGG + Intergenic
1179226721 21:39460224-39460246 GTGTGGCTTTTTTATGTGCTGGG + Intronic
1181845717 22:25707234-25707256 CTGGGGCATTTCTAATTGCTTGG + Intronic
952421596 3:33136619-33136641 GTGTGGCAATGGCATCTGCTTGG + Intronic
954307171 3:49734441-49734463 GAGTGGCATTTGAAGTTGCTGGG - Intronic
954917783 3:54163713-54163735 GTGTGACATTTGTTTCTGCATGG - Intronic
962879427 3:139562256-139562278 GTGTGGCATTTGTAACTGCTGGG + Intronic
963460796 3:145612617-145612639 GTGGGGCACATGTAACTACTTGG + Intergenic
965371736 3:167871208-167871230 GTGTGGCATTTCTTCCTCCTGGG + Intergenic
969715021 4:8864179-8864201 GTCTGTAATTTGTAAATGCTGGG - Intronic
970941024 4:21633404-21633426 GTGTGGCATTTTTATTAGCTTGG - Intronic
973644752 4:52939150-52939172 GGTTGGCATTTGTATCTGTTAGG - Intronic
974467153 4:62272057-62272079 GTGTGGCATTTCTTTCTTCTGGG - Intergenic
974902256 4:68015162-68015184 GTATAGCATTTGTAACTCTTGGG - Intergenic
977648980 4:99447424-99447446 TTGTGACATTTGTAACTTTTAGG - Intergenic
980442256 4:132864795-132864817 GTGTTGCCTTTGTAGCTCCTGGG + Intergenic
981320310 4:143384573-143384595 GTGTAGCATTTGTCTCTGTTGGG - Intronic
981451399 4:144901700-144901722 CTGTGAAATTTGCAACTGCTGGG - Intergenic
990333098 5:54746430-54746452 GTGTTGTATGTGTACCTGCTTGG + Intergenic
994483425 5:100364379-100364401 GTGTGGCTTTTGTCTCTACTTGG + Intergenic
999118727 5:149189835-149189857 GAGTGGAATTTGGAATTGCTGGG - Intronic
999950035 5:156638845-156638867 GTGTAGAATTTGAAACTGCAGGG - Intronic
1001308669 5:170594957-170594979 ATGTGGCATTTAAAACTGCATGG - Intronic
1002763714 6:221245-221267 GTGTGCCATTTCTAACTTCATGG + Intergenic
1003750393 6:9048802-9048824 GTGTATCTTTTGTAACAGCTGGG - Intergenic
1004615949 6:17289104-17289126 TTGTGCTTTTTGTAACTGCTAGG + Intronic
1005524836 6:26636258-26636280 GTGTGGCATGTGTTACTGTTGGG - Exonic
1008004131 6:46392028-46392050 TTGTGGCATTTATTTCTGCTGGG - Intronic
1008130881 6:47719345-47719367 GAGTGGCATGTGTTAGTGCTGGG + Intronic
1013085072 6:106849839-106849861 GTCCGTCATTTGTAACTGCTAGG - Intergenic
1014426645 6:121314758-121314780 CTGGGCCATTTTTAACTGCTTGG - Intronic
1015326002 6:131924169-131924191 GTGTTGTGTTTGCAACTGCTAGG - Intergenic
1015510709 6:134035403-134035425 GTGTGGCATTTCTTCCTCCTGGG - Intronic
1019784444 7:2966274-2966296 ATGTGGCACTTGTATCTGTTAGG - Intronic
1021801210 7:24308753-24308775 GTGTAGTCTTTGTCACTGCTTGG + Intergenic
1023560190 7:41465986-41466008 GTGGAGGAGTTGTAACTGCTTGG + Intergenic
1032724560 7:134578614-134578636 GTCTGGCATTTATTACTGCGAGG + Intronic
1034849043 7:154476756-154476778 GTTTTGTTTTTGTAACTGCTGGG - Intronic
1035375317 7:158403542-158403564 GTGTGGCCTTTGTTACTCCAAGG + Intronic
1038050351 8:23803650-23803672 GTGTGGCATTTGTAAATACCAGG - Intergenic
1040355540 8:46614487-46614509 GTGTGGCATTTGGCCCTGTTTGG - Intergenic
1042674055 8:71299050-71299072 CTGTGGGATCTGTAACTGCTTGG + Exonic
1043927562 8:86054673-86054695 CTGGGGCATTTGTAAATTCTGGG + Intronic
1044209047 8:89528098-89528120 GTATGGCTGTTGTACCTGCTTGG + Intergenic
1051461611 9:17323840-17323862 GTGTGACCTTGTTAACTGCTAGG - Intronic
1051580367 9:18666674-18666696 GTGTGGCATTTTTACCTCTTGGG + Intronic
1055291794 9:74789173-74789195 CTGTGGCATTTACCACTGCTGGG + Intronic
1056033519 9:82579524-82579546 GCATGGCATCTGTATCTGCTTGG - Intergenic
1057107995 9:92439002-92439024 GTATGGCCTTAGTAAATGCTTGG + Intronic
1057682027 9:97197221-97197243 GTGTGGCATGTGTTACTGTTGGG - Intergenic
1059977788 9:119736623-119736645 GTGTGTTATGTGTAACTGATGGG - Intergenic
1060726750 9:126011239-126011261 GTGTGGCACTTGTCACTTTTGGG + Intergenic
1061045890 9:128164699-128164721 CTGTGGCATTCCAAACTGCTGGG - Intergenic
1061633871 9:131892948-131892970 GTGTGGAATGTGGAAATGCTGGG + Intronic
1061954494 9:133954592-133954614 GTGTGGCACATGTAAGTGCTTGG - Intronic
1187170973 X:16851595-16851617 CTGTGGGTTGTGTAACTGCTGGG - Intronic
1187895302 X:23974696-23974718 GTGCGGCCTTTGGAGCTGCTGGG - Intergenic
1187914025 X:24135973-24135995 GTGCGGCCTTTGGAGCTGCTGGG - Intergenic
1190969731 X:55336879-55336901 ATGTGGCATTTCAAACAGCTTGG + Intergenic
1192587419 X:72329956-72329978 TTGTGGAATTTGTGACTGCAGGG - Exonic
1196823705 X:119724323-119724345 GTGTGGCACTGGCATCTGCTAGG + Intergenic
1197196378 X:123705810-123705832 GTGTGGGATTTGAAGCTTCTTGG - Intronic
1199017536 X:142836225-142836247 GAATGGCATTTGTTACAGCTCGG + Intergenic
1200367142 X:155678639-155678661 GTATGGCATTTTTAAATACTTGG + Intergenic