ID: 962880587

View in Genome Browser
Species Human (GRCh38)
Location 3:139572903-139572925
Sequence AAGTCGGGAGACCCTGCCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962880579_962880587 25 Left 962880579 3:139572855-139572877 CCAGCATTCCTAAACTCTTCTAT 0: 1
1: 0
2: 1
3: 21
4: 203
Right 962880587 3:139572903-139572925 AAGTCGGGAGACCCTGCCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 49
962880577_962880587 27 Left 962880577 3:139572853-139572875 CCCCAGCATTCCTAAACTCTTCT 0: 1
1: 1
2: 4
3: 23
4: 250
Right 962880587 3:139572903-139572925 AAGTCGGGAGACCCTGCCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 49
962880581_962880587 17 Left 962880581 3:139572863-139572885 CCTAAACTCTTCTATTCTGGAAG 0: 1
1: 0
2: 3
3: 26
4: 241
Right 962880587 3:139572903-139572925 AAGTCGGGAGACCCTGCCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 49
962880578_962880587 26 Left 962880578 3:139572854-139572876 CCCAGCATTCCTAAACTCTTCTA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 962880587 3:139572903-139572925 AAGTCGGGAGACCCTGCCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962880587 Original CRISPR AAGTCGGGAGACCCTGCCGT AGG Intronic
905734736 1:40317244-40317266 GCGCCGGGAGACTCTGCCGTCGG - Exonic
907614843 1:55913188-55913210 CAGTCAGGACACCCTGCCTTTGG + Intergenic
907615702 1:55923689-55923711 AAGTCAGGAAACCCTGCTGCAGG - Intergenic
911998176 1:104794746-104794768 AAGTCAGGAGAGCCTTCCGTAGG - Intergenic
922196343 1:223363603-223363625 AAGGCGGGGGACCTCGCCGTGGG - Exonic
923475216 1:234325407-234325429 AAGTGGGGAAGCCCTGCCTTAGG + Intergenic
1064681158 10:17812032-17812054 AAGTAGGGAGACCTTCCCATGGG - Intronic
1068800200 10:61131876-61131898 AAATCTGGAGACCCTGCTATAGG - Intergenic
1069073368 10:64013069-64013091 AGGTTTGGAAACCCTGCCGTAGG - Intergenic
1077090195 11:774950-774972 GAGTGGGGAGCCCCTGCAGTTGG - Intronic
1077492739 11:2869731-2869753 ACGGCGGGAGAGCCTGCGGTCGG - Intergenic
1081235133 11:40637953-40637975 AAGTGGGGAGGCCCTGATGTGGG - Intronic
1091328413 11:134711006-134711028 AAGTCAGGTGTCCCTGCCATCGG + Intergenic
1103821338 12:123701256-123701278 AAATGGGGAGAGACTGCCGTGGG + Intronic
1125890035 15:43258919-43258941 AGGTGGAGAGACCCTGCCATGGG - Intronic
1128251262 15:66165783-66165805 ACGGAGGGAGACCCTGCCTTTGG - Intronic
1128357887 15:66941284-66941306 AAGGCGGGAGACCCAGGCATAGG + Intergenic
1132599762 16:768254-768276 AAGTCTGGAGAGGCTGCGGTGGG + Intronic
1133278707 16:4652974-4652996 AAGTGGGGAGTCCCTGGGGTGGG - Intronic
1137712491 16:50576006-50576028 AGGTGGAGAAACCCTGCCGTAGG + Intronic
1142410743 16:89915388-89915410 AAGTGGGGTGACCCTGCCACAGG - Intronic
1146287345 17:31582723-31582745 AAGTCCTGAGACTCTGCCATGGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
925515340 2:4674945-4674967 AAGAGGGGAGACCCTGCGGTGGG - Intergenic
930022787 2:47011607-47011629 GAGTCAGGGGACCCTGCCATTGG - Intronic
931677422 2:64711295-64711317 AAGTCAGGAGACCCCACCCTTGG - Intronic
935595307 2:104873310-104873332 AAGCCGGGCGACCCGGCCGCGGG - Intergenic
937922211 2:127138430-127138452 CAGTCGTGGGACCCTGCTGTTGG - Intergenic
938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG + Intergenic
940398653 2:153222269-153222291 AAGTCGGGAAAACCTGCCTGCGG - Intergenic
948497550 2:238362006-238362028 AGGTCAGGTGACCCTGCCGAGGG - Intronic
1171360262 20:24582266-24582288 AAGGGGGGAGACCGTGCAGTGGG - Intronic
1179674783 21:42974284-42974306 AAGGCGGGAGGCTCTGCCTTCGG + Intergenic
1180179116 21:46110076-46110098 AGGTCTGGAGACCCTGCCCCAGG - Intronic
1180648820 22:17361960-17361982 GAGTTGGGAGACACTGCAGTAGG + Intronic
957957160 3:87202259-87202281 AAGGTGGCAGACCTTGCCGTTGG + Intergenic
962880587 3:139572903-139572925 AAGTCGGGAGACCCTGCCGTAGG + Intronic
967236002 3:187384236-187384258 AAGTATGGAGACCTTGCCTTGGG - Intergenic
986743963 5:10728037-10728059 CAGTTGGGTGACTCTGCCGTGGG + Intronic
1006752935 6:36390495-36390517 AAGTGGCTAGACCCTGCTGTGGG + Intergenic
1014126466 6:117781884-117781906 AAGTTGGGAGAGCCTTCTGTTGG + Intergenic
1020788384 7:12595388-12595410 AAGTCTGGTGACCTTGCTGTAGG + Intronic
1022217188 7:28275019-28275041 AATTCGAGAGACCCTGCTTTAGG + Intergenic
1048155403 8:131943573-131943595 AAGTTGAGAAACCCTGCCCTAGG - Intronic
1049640007 8:143711244-143711266 AAGTGGGGAGAGCCTGGCCTTGG + Intronic
1054906467 9:70418324-70418346 AGGTGGGGAAACCCTGCCTTGGG - Intergenic
1055744345 9:79426664-79426686 CAGTCTGGAGGCCCTGCCCTTGG - Intergenic
1060413596 9:123415634-123415656 AGGCCTGGAGACCCTGCGGTGGG - Intronic
1060772334 9:126341607-126341629 AAGTTGGGAAACCCTGCCTTAGG - Intronic
1062235727 9:135506683-135506705 AAGAGGGGAGAGCCTGCCCTGGG + Intergenic
1062342168 9:136098605-136098627 AAGGTGGGAGACCGTGCCGATGG - Intergenic
1186209256 X:7232644-7232666 AGGTCTGGAGACCCTGCGATTGG + Intronic
1191112788 X:56820908-56820930 AAGTTGGGAGAGGCTGCCTTGGG - Intergenic